U.S. government gave $3.7 million grant to Wuhan lab at cent

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 9:32 am

Part 1 of 2

Interview with Andrew Kimball on the Ralph Nader Radio Show
Ralph Nader Radio Hour Episode 332
July 18, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


Steve Skrovan: It's the Ralph Nader Radio Hour.

[Music] Stand up, stand up, you've been sitting way too long.

Steve Skrovan: Welcome to the Ralph Nader Radio Hour. My name is Steve Skrovan along with my co-host David Feldman. Hello, David.

David Feldman: Hello, everybody.

Steve Skrovan: And the man of the hour, Ralph Nader. Hello, Ralph.

Ralph Nader: Hello, everybody.

Steve Skrovan: Ralph, you wanted to open the show. You got a few things to say.

Ralph Nader: Yeah. Boeing has lost more than 800 orders by airlines for the 737 MAX so far this year. Still moving ahead to try to, by September, give it the okay to fly. There are more defects being documented in the 737 MAX that haven't been investigated by congressional committees yet, or openly by the FAA. So I just wanted to bring all this up to date. There will be more cancellations, analysts predict. And Boeing is discounting the price to try to hold its existing orders.

The second news was a sad one. Edward Kleinbard, a corporate tax lawyer who worked for corporate tax firms for years and then turned against what they were doing--getting loopholes from multinational corporations like Apple and Google and international banks and so forth--went to teach at the law school at the University of Southern California. The New York Times, where he was a regular contributor before he lost his struggle with cancer, [July 10, 2020] said of him, "Most tax policy discussions were backward. Policymakers should identify their spending priorities, ideally to invest in the country's citizens and then discuss the proper tax policies to pay for them." And I'm quoting him again in an article he wrote. "The starting point in every case should not be determined by establishing an arbitrarily small amount of tax to collect and then treating government like an institutional Procrustes, whose only responsibility is to amputate the welfare of our fellow citizens to suit that amount." And one of his friends who is also a tax lawyer, said that "Edward Kleinbard, by being in academia, that is free to speak out, and by being a good writer, he was able to bring all that to the public attention." All that meaning incredibly clever tax loopholes that often bring the tax rate in reality down to 1%/2%, if that, for these giant corporations that are making billions of dollars of profits every year. So the public has lost a champion, Edward Kleinbard.

Steve Skrovan: Well, that's a great tribute, Ralph. Thanks for that. There's also another piece of business we want to get to before we get to the main part of our show today. A few weeks ago, as many of you recall, we talked to Dr. John Geyman. We said if you emailed him, he would send his book on healthcare reform to your congressperson in your name. And the response was great. So far he's gotten 95 requests; we want to re-up that. If you would like to join in on this effort, you could still email John Geyman with your name and who you want the book sent to. That'll be at [email protected]. That's J-G-E-Y-M-A-N @uw.edu. And we'll also link to it at the Ralph Nader Radio Hour website if you didn't catch that.

Ralph Nader: And a few more suggestions, how to make it more effective with your senators and representative. Give your full contact; add a couple of sentences about why you think full Medicare for All should be reflected in your senators’ and representative’s votes, and ask the senators or representative to acknowledge receipt of the book and to give you a call, because you have other points you want to make and other experiences you want to reflect. If you do all that very concisely, you will triple the likelihood that this is going to get attention in the Washington, D.C., offices of those members of Congress in your state.

Steve Skrovan: There you go, people. You’ve got your marching orders. We're very pleased with the response so far. Let's keep it going. Our first guest on the show today is Andrew Kimbrell. He has been on the show twice before to talk about why GMOs help corporations and not consumers. And this time, though, he isn't here to talk about genetically modified crops, but rather genetically engineered viruses and how the risks of reckless genetic engineering could potentially lead to more novel viruses. And that's just the first half of the show. In the second half, we’re welcoming back Dr. Michael Carome. He is the director of Public Citizen's Health Research Group. We're going to talk to him about the letter Public Citizen released a few days ago directed at President Trump and Vice President Pence. The letter in question lays out the ways this administration has mishandled the coronavirus crisis. The letter is asking for Trump and Pence to step aside and allow public health experts to take charge. In between, we'll take a short break and check in with our corporate crime reporter Russell Mokhiber. But first, let's talk about genetically engineered viruses. David?

David Feldman: Andrew Kimbrell is an internationally recognized public interest attorney, bioethicist and NGO [non-governmental organization] leader. Mr. Kimbrell has been at the forefront of efforts to strictly regulate biotechnology, ensure responsible bio-medical research and eliminate biological weapons research. He is the founder and executive director of the Center for Food Safety, the author of Your Right to Know: Genetic Engineering and the Secret Changes in Your Food, and the editor of Fatal Harvest: The Tragedy of Industrial Agriculture. Welcome to the Ralph Nader Radio Hour, Andrew Kimbrell.

Andrew Kimbrell: Thanks, Dave. Appreciate the intro.

Ralph Nader: Yeah, welcome indeed, Andy. Before we get to the coronavirus COVID-19 aspect of our discussion, let's start with your point about lack of public knowledge or debate about what researchers around the world are genetically engineering.

Andrew Kimbrell: Yeah, Ralph, I think this is really just an absolutely critical issue that's been lost -- the forest has been lost for the trees, if you will. We have talked on your show, and you've worked on this a lot, about the dangers of genetic engineering of plants, animals, or humans. But we haven't talked much about the danger of genetically engineering viruses. And I think far away from public debate, a small group of scientists over the last 10 or 11 years have used synthetic biology, synthetic virology, to be able to do something which is breathtaking. What they've done is they've taken the most dangerous viruses known to man -- these are H5N1, bird flu, Marburg, Ebola, SARS -- and instead of trying to find vaccines, or to make these viruses less lethal, they have actually spent millions and millions of our taxpayer dollars, tens of millions of our taxpayer dollars, trying to make these viruses more dangerous, by mixing and matching various parts of these viruses with other viruses, genetically engineering them, and then using animal experimentation, and human cell line experimentation, to make them more transmissible, to make them more lethal, to make them more infectious.

Ralph Nader: Scientifically, why would they want to do this?

Andrew Kimbrell: Well, I do have a master's degree in psychology, and I think I have to sort of rely on that to try and figure out why anybody would want to do this. One prominent virologist has called it the definition of insanity. I think there is a temptation, and this probably goes back, Ralph, to the creation of nuclear weapons, the early experimentations that we all saw with genetic engineering, putting human genes into pigs, and doing all sorts of crazy things. There's this problem with some of our scientists that just because you can do something, they think that you should do it. There really is no end. Marc Lipsitch from Harvard, and Thomas Inglesby, a prominent health security expert at Johns Hopkins, they've gone to great lengths to show there's no value, that we've actually gotten zero value from these experiments. The [scientists] say, "Hey, if we create these novel, brand new pandemic viruses, maybe nature will create them later, and we'll have some kind of intervention strategy for them." But that makes no sense, of course, because nature has a million different variations that we would never be able to predict. So the idea that we can somehow predict in the laboratory, and then spend tens of millions of dollars trying to find an intervention strategy when there could be millions of other combinations out there in nature, makes no sense.

Occasionally an epidemic of avian flu spills over to humans and can give rise to hundreds of H7N9 infections in man in a matter of months. Fortunately, these viruses are almost never transmitted from human to human. This is the same as with the rabies virus. Such dead end infections are not new in virology. The question is could these viruses become transmittable between humans and if so how? In modern virological parlance, what mutations are necessary to convert such a virus into a highly transmissible virus between ferrets, the animal of choice in influenza biology. This is the basis of the H5N1 projects of Fouchier and Kawaoka. As is now well known, they succeeded in doing this for the H5N1 virus and it involved a handful of mutations.

It should be emphasized that the conditions in a laboratory differ enormously from those in nature. Influenza virus evolution takes years, while in a laboratory there is a massive acceleration thanks to the selection of mutants by the virologist.
To illustrate this, suffice to say that for some reason nature has not yet succeeded in morphing any influenza virus into a major human pathogen other than H1N1, H2N2 and H3N2 in 100 years. Even the resurrection of the Spanish flu HIN1 virus did not help us to predict or prepare for the H1N1 flu pandemic of 2009.

This is one of the major scientific weaknesses in the so-called gain-of-function influenza research. We do not know if the experiments reflect what happens in nature. As an HIV expert he can say this because the lab is not a good template for what happens in the clinic. There are hundreds of possible trajectories and only a few can be tested in laboratory. One can never know which are the “right ones” -– that can only be appreciated as being “right” once the pandemic has struck. As for obvious ethical reasons these experiments cannot be done in humans, an important objection to this work is that it is not falsifiable. This constitutes a real issue as science tries to solve problems, not to create them.

-- Gain-Of-Function Research: Report of a Debate between Prof. Giorgio Palù and Prof. Simon Wain-Hobson, 25 June 2014, Trippenhuis, Amsterdam, by Koos van der Bruggen


There is one unfortunate place where this kind of research could be useful, and that would be the creation of biological weapons.

Ralph Nader: I was going to say, Andy, and we spoke about this before, that before Richard Nixon put an end, at least officially, to biological warfare research by the US government, the government was funding scientists in ways that would really startle people. For example, there was a page one story many years ago, before the research was officially stopped, by the Wall Street Journal, which described a University of Wisconsin scientist on a government contract, Department of Defense contract, working in the lab to discover a more virulent form of Dengue fever; basically to develop a more virulent form of Dengue fever. So in the biological warfare context, they do all these things. Do you think this was sort of a precursor for this scientific curiosity [COVID-19]? And by the way, the scientists who do this do give us scientific justification. But how do you connect the two events here, the biological warfare . . .

Andrew Kimbrell: Well, first of all, you're absolutely right. Now that you mention it, I do feel compelled to mention Caspar Weinberger, who we all remember as the Secretary of Defense under Ronald Reagan. Caspar Weinberger, pretty much singlehandedly rejuvenated the entire biological weapons program in the United States, called the Biological Defense Research Program. I litigated against this about five times, because these experiments were so dangerous. He felt that since there was sort of a stand-off with nuclear weapons, why doesn't the United States get ahead on biological weapons? This happened throughout the 1980s and into the early '90s. We were successful in closing down experiments in Dugway, Utah and in Fort Detrick, Maryland, and actually ordering, through the National Environmental Policy Act, programmatic environmental impact statements on the entire program. And it was eventually shut down after the first Persian Gulf War because of their failure to come up with an anthrax vaccine. And that infuriated Senators John Glenn and Carl Levin who helped close down that program.

Unfortunately, I think after 9/11, I have had I think credible information that they have revived some, but not all of those experiments. And they were incredibly dangerous, and mixing all [kinds of] toxins, viruses, bacteria. You can imagine how we had a lot of discovery there that was very, very frightening. But I think again, the excuse for this kind of insanity of taking viruses and creating new novel pandemic viruses in laboratories, is because that might just happen in nature, and we'd have them in a laboratory ready to study, and maybe even have a vaccine. Again, the problem with that is…

Let me just give you an example. So there's something called H5N1 bird flu. Most people have heard of it. Just a few hundred people have been infected by it, but it has a 60% mortality. Whoever gets it, 60% of the people die. Compare that to, for example, what's happening with COVID-19; some people say it's 1%, 4%, we'll see. But imagine 60%. Well, two researchers, Ron Fouchier who's up at the University of Erasmus in Netherlands, and Yoshihiro Kawaoka who is a researcher at University of Wisconsin, they said, "You know what, this isn't very infective, this bird flu. What if we were able to create a version that is airborne? You could get like the common cold. Let's try that." And they did. They actually were able to create this virus. So if this virus escapes, right, 1.6 billion people could die, 60% of the world's population. Well, this caused a huge furor. In 2014, the Obama administration actually declared a moratorium on this gain of function--gain of threat. I don't like calling it gain of function because that's euphemistic; it's gain of threat research, great threat, creating novel pandemic viruses. They said, "This is just too dangerous."

Ralph Nader: Let me ask you a connected question here. They have these labs all over the world. They're in Europe, Africa, Asia, South America, North America; they're everywhere. What has been the record of the security of these labs? Because even Fort Meade in Maryland has had problems with security for this dangerous research. I mean they have to have like 100% perfection that none of this stuff will leak out of the lab. What has been the experience?

Andrew Kimbrell: Well, there's four levels of biological safety [BLS] 1, 2, 3 and 4; 4 being the strongest and 1 being the weakest. You want some of these most dangerous experiments to be BLS 4, and of course I'm suggesting that we should never have this kind of experimentation at all; it should never happen! But the record is very poor. Every year we have over 100 accidents, and that's just the ones that are reported. There have been deaths, quarantining, and we've had numerous accidents. And then just this October, just a month or so before we began to learn about this COVID-19, the Global Health Security Index, for the first time, did a 195-country survey and said, "Exactly how much biosecurity is out there?" Exactly the question you asked, Ralph. And their answer was, and get ready for this, that out of a score of 100 on a number of different biosecurity and safety points, out of a best possible score of 100, the average country of these 195 countries was 40.1 out of 100. Even the wealthier countries were 51 out of 100. A country like China that's doing a lot of these experiments, was 51st in the world. So 50 countries were more safe than China. In other countries, the BSL 4 laboratories were even worse, such as Israel and the Czech Republic. So it is abysmal that with the billions of dollars that have gone out to the biomedical research industrial complex, if you want to call it that, for all these years and all these dangerous experiments, much less these gain of threat experiments that threaten half the world's population today as we speak, because that moratorium was lifted, and in secret the NIH [National Institutes of Health] preapproved Ron Fouchier's experiments in the Netherlands at Erasmus Medical Center and Kawaoka's experiments in University of Wisconsin. So airborne bird flu research is ongoing right now every day; and we have a 3% out of 100 % safety; that combination really should keep us up at night!

Executive Summary

Biological threats—natural, intentional, or accidental—in any country can pose risks to global health, international security, and the worldwide economy. Because infectious diseases know no borders, all countries must prioritize and exercise the capabilities required to prevent, detect, and rapidly respond to public health emergencies. Every country also must be transparent about its capabilities to assure neighbors it can stop an outbreak from becoming an international catastrophe. In turn, global leaders and international organizations bear a collective responsibility for developing and maintaining robust global capability to counter infectious disease threats. This capability includes ensuring that financing is available to fill gaps in epidemic and pandemic preparedness. These steps will save lives and achieve a safer and more secure world.

The Global Health Security (GHS) Index is the first comprehensive assessment and benchmarking of health security and related capabilities across the 195 countries that make up the States Parties1 to the International Health Regulations (IHR [2005]).2 The GHS Index is a project of the Nuclear Threat Initiative (NTI) and the Johns Hopkins Center for Health Security (JHU) and was developed with The Economist Intelligence Unit (EIU). These organizations believe that, over time, the GHS Index will spur measurable changes in national health security and improve international capability to address one of the world’s most omnipresent risks: infectious disease outbreaks that can lead to international epidemics and pandemics.

The GHS Index is intended to be a key resource in the face of increasing risks of high-consequence3 and globally catastrophic4 biological events and in light of major gaps in international financing for preparedness. These risks are magnified by a rapidly changing and interconnected world; increasing political instability; urbanization; climate change; and rapid technology advances that make it easier, cheaper, and faster to create and engineer pathogens.


Developed with the guidance of an international expert advisory panel, the GHS Index data are drawn from publicly available data sources from individual countries and international organizations, as well as an array of additional sources including published governmental information, data from the World Health Organization (WHO), the World Organisation for Animal Health (OIE), the Food and Agriculture Organization of the United Nations (FAO), the World Bank, country legislation and regulations, and academic resources and publications. Unique in the field, the GHS Index provides a comprehensive assessment of countries’ health security and considers the broader context for biological risks within each country, including a country’s geopolitical considerations and health system and whether it has tested its capacities to contain outbreaks.

Knowing the risks, however, is not enough. Political will is needed to protect people from the consequences of epidemics, to take action to save lives, and to build a safer and more secure world.

WHY IS THE GHS INDEX NEEDED?

It is likely that the world will continue to face outbreaks that most countries are ill positioned to combat. In addition to climate change and urbanization, international mass displacement and migration—now happening in nearly every corner of the world—create ideal conditions for the emergence and spread of pathogens. Countries also face an increased potential threat of accidental or deliberate release of a deadly engineered pathogen, which could cause even greater harm than a naturally occurring pandemic. The same scientific advances that help fight epidemic disease also have allowed pathogens to be engineered or recreated in laboratories. Meanwhile, disparities in capacity and inattention to biological threats among some leaders have exacerbated preparedness gaps. The GHS Index seeks to illuminate those gaps to increase both political will and financing to fill them at the national and international levels. Unfortunately, political will for accelerating health security is caught in a perpetual cycle of panic and neglect. Over the past two decades, decision makers have only sporadically focused on health security, despite concerns stemming from the 2001 anthrax attacks, the emergence of the Severe Acute Respiratory Syndrome and Middle East Respiratory Syndrome coronaviruses, and the looming threat of a pandemic caused by a novel strain of influenza.

In September 2014, the United Nations (UN) Security Council met in crisis over the growing Ebola epidemic in West Africa. Massive global assistance was needed to stop the outbreak because of insufficient national capacities in Guinea, Liberia, and Sierra Leone to quickly detect and respond to the epidemic.

As a result, the West Africa Ebola epidemic killed at least 10,000 people and infected more than 28,000.5 The three affected countries lost $2.8 billion in combined GDP, and a massive global response totaled billions of dollars before the outbreak was contained. The crisis awakened the world to the reality that pathogens can emerge unexpectedly, and when outbreaks occur in countries that are unprepared, they can spill beyond borders, threatening the peace, health, and prosperity of all countries.
However, despite newly available vaccines and therapies, response to the Ebola outbreak that began in 2018 in eastern Democratic Republic of Congo has been hampered by violence and instability, community resistance to outbreak mitigation measures, hospital transmission, delays in detection and isolation, and lack of funding and resources.

Delays in the global response to Ebola in 2014 led to a restructuring of the WHO and prompted calls for measurement and transparent reporting of countries’ public health capacities, including the launch of the voluntary WHO IHR Joint External Evaluations (JEEs). Since then, health, policy, and security leaders have developed numerous high-level reviews and recommended ways to identify, finance, and fill major preparedness gaps. These recommendations are relevant for epidemic threats, such as Ebola, and high-consequence pandemic threats, such as a fast-spreading respiratory disease agent that could have a geographic scope, severity, or societal impact and could overwhelm national or international capacity to manage it.6 Some of those recommendations have been implemented, but many have been shelved owing in part to lack of financing. Nearly all recommendations pointed to a need to better understand and measure—on a transparent, global, and recurring basis—the state of international capability for preventing, detecting, and rapidly responding to epidemic and pandemic threats.

The GHS Index is designed to meet this need.

DEVELOPING THE GHS INDEX

The NTI, JHU, and EIU project team—with generous grants from the Open Philanthropy Project, the Bill & Melinda Gates Foundation, and the Robertson Foundation—worked with an international advisory panel of 21 experts from 13 countries to create a detailed and comprehensive framework of 140 questions, organized across 6 categories, 34 indicators, and 85 subindicators to assess a country’s capability to prevent and mitigate epidemics and pandemics.

The GHS Index relies entirely on open-source information: data that a country has published on its own or has reported to or been reported by an international entity. The GHS Index was created in this way with a firm belief that all countries are safer and more secure when their populations are able to access information about their country’s existing capacities and plans and when countries understand each other’s gaps in epidemic and pandemic preparedness so they can take concrete steps to finance and fill them. The indicators and questions that compose the GHS Index framework also prioritize analysis of health security capacity in the context of a country’s broader national health system and other national risk factors.

The 140 GHS Index questions are organized across six categories:

1. PREVENTION: Prevention of the emergence or release of pathogens

2. DETECTION AND REPORTING: Early detection and reporting for epidemics of potential international concern

3. RAPID RESPONSE: Rapid response to and mitigation of the spread of an epidemic

4. HEALTH SYSTEM: Sufficient and robust health system to treat the sick and protect health workers

5. COMPLIANCE WITH INTERNATIONAL NORMS: Commitments to improving national capacity, financing plans to address gaps, and adhering to global norms

6. RISK ENVIRONMENT: Overall risk environment and country vulnerability to biological threats

Among its 140 questions, the GHS Index prioritizes not only countries’ capacities, but also the existence of functional, tested, proven capabilities for stopping outbreaks at the source. Several questions in the GHS Index are designed to determine not only whether a capacity exists, but also whether that capacity is regularly—for example, annually—tested and shown to be functional in exercises or real-world events.

The GHS Index also includes indicators of nations’ capacities and capabilities to reduce Global Catastrophic Biological Risks (GCBRs), which are biological risks of unprecedented scale that could cause severe damage to human civilization at a global level, potentially undermining civilization’s long-term potential.7 These are events that could wipe out gains in sustainable development and global health because of their potential to cause national and regional instability, global economic consequences, and widespread morbidity and mortality.

FINDINGS AND RECOMMENDATIONS

This report summarizes the results of the first GHS Index, including overall findings about the state of national health security capacity across each of the six GHS Index categories, as well as additional findings specific to functional areas of epidemic and pandemic preparedness. The full report also offers 33 recommendations to address gaps identified by the GHS Index. All the findings and recommendations are summarized on pages 12–15 and described in detail throughout the full report, which begins on page 31.

Whereas every country has a responsibility to understand, track, improve, and sustain national health security, new and increased global biological risks may require approaches that are beyond the control of individual governments and will necessitate international action. Therefore, the recommendations contained in this report are made with the understanding that health security is a collective responsibility, and a robust international health security architecture is required to support countries at increased risk. As a result, in addition to the many recommendations intended for national leaders, the GHS Index also includes recommendations aimed at decision makers within the UN system, international organizations, donor governments, philanthropies, and the private sector. These are especially important in the case of fast-spreading, deliberately caused, or otherwise unusual outbreaks that could rapidly overwhelm the capability of national governments and international responders.

OVERALL FINDING: National health security is fundamentally weak around the world. No country is fully prepared for epidemics or pandemics, and every country has important gaps to address.

The GHS Index analysis finds no country is fully prepared for epidemics or pandemics. Collectively, international preparedness is weak. Many countries do not show evidence of the health security capacities and capabilities that are needed to prevent, detect, and respond to significant infectious disease outbreaks. The average overall GHS Index score among all 195 countries assessed is 40.2 of a possible score of 100. Among the 60 high-income countries, the average GHS Index score is 51.9. In addition, 116 high- and middle-income countries do not score above 50. Overall, the GHS Index finds severe weaknesses in country abilities to prevent, detect, and respond to health emergencies; severe gaps in health systems; vulnerabilities to political, socioeconomic, and environmental risks that can confound outbreak preparedness and response; and a lack of adherence to international norms.

Specific scores for the GHS Index categories are as follows:

PREVENTION: Fewer than 7% of countries score in the highest tier8 for the ability to prevent the emergence or release of pathogens.  

DETECTION AND REPORTING: Only 19% of countries receive top marks for detection and reporting.

RAPID RESPONSE: Fewer than 5% of countries scored in the highest tier for their ability to rapidly respond to and mitigate the spread of an epidemic.

HEALTH SYSTEM: The average score for health system indicators is 26.4 of 100, making it the lowest-scoring category.

COMPLIANCE WITH INTERNATIONAL NORMS: Less than half of countries have submitted Confidence-Building Measures under the Biological Weapons Convention (BWC) in the past three years, an indication of their ability to adhere to important international norms and commitments related to biological threats.

RISK ENVIRONMENT: Only 23% of countries score in the top tier for indicators related to their political system and government effectiveness.

_______________

Notes:

1. As of April 16, 2013, there are 196 States Parties to the World Health Organization (WHO) 2005 International Health Regulations (IHR), including the Holy See. The Holy See is a sovereign juridical entity under international law, but it was not included in the country-specific research for this Index in light of the Holy See’s lack of an independent health system. This report will refer to the assessed “States Parties” as “195 countries.”

2. The WHO IHR (2005) is the foundational international standards for health. The IHR (2005) is a binding legal instrument to address cross-border public health risks. The goal of the IHR (2005) is to prevent, protect, control, and respond without disrupting international trade and traffic. The IHR (2005) provided the guiding regulations behind many of the indicators included in the GHS Index.

3. High-consequence biological events are defined here as infectious disease outbreaks that could overwhelm national or international capacity to manage them. For example, although international health security has improved following the 2014–2016 Ebola epidemic in West Africa, countries and international responders are not prepared to quell outbreaks that occur in violent or insecure settings; deliberate biological events that require close coordination and investigative links between security, health, and humanitarian actors; and fast-moving respiratory diseases with high mortality that could spread rapidly to become global pandemics.

4. Global Catastrophic Biological Risks are biological risks of unprecedented scale that could cause severe damage to human civilization at a global level, potentially undermining its long-term potential. See Nick Alexopoulos, “Center for Health Security Publishes First Working Definition of Global Catastrophic Biological Risks,” Johns Hopkins Center for Health Security, July 27, 2017, http://www.centerforhealthsecurity.org/ ... ition.html.

5. Centers for Disease Control and Prevention, “2014–2016 Ebola Outbreak in West Africa,” http://www.cdc.gov/vhf/ebola/history/20 ... index.html.

6 United Nations General Assembly, “Protecting humanity from future health crises: Report of the High-level Panel on the Global Response to Health Crises,” https://www.un.org/ga/search/view_doc.a ... l=A/70/723.

7. Monica Schoch-Spana et al.,“Global Catastrophic Biological Risks: Toward a Working Definition,” Health Security 15, no. 4 (2017): 323–28, http://www.liebertpub.com/doi/full/10.1089/hs.2017.0038.

8 The GHS Index scoring system includes three tiers. Countries that score between 0 and 33.3 are in the bottom tier (also called “low scores”), countries that score between 33.4 and 66.6 are in the middle tier (also called “moderate scores”), and countries that score between 66.7 and 100 are in the upper or “top” tier (also called “high scores”)

-- 2019 Global Health Security Index: Building Collective Action and Accountability, by Nuclear Threat Initiative, Center for Health Security, Johns Hopkins Bloomberg School of Public Health, and The Economist Intelligence Unit


Ralph Nader: The obvious question is how come there have been no catastrophes? With this kind of security, and the leakage of all this lab work with virulent bacteria and virulent viruses around the world, how come there hasn't been any catastrophes?

Andrew Kimbrell: There have been catastrophes, obviously. The SARS virus leaked twice from Beijing laboratories in China, and there were deaths.

Example 4: SARS laboratory escapes outbreaks after the SARS epidemic

The SARS outbreak of 2002-2003 eventually spread to 29 countries, causing over 8,000 infections and at least 774 deaths. Because many cases were in hospital workers (1707, amounting to 21%), it had the potential to shut down health care services where it struck33. By imposing strict (sometimes draconian) quarantines on exposed persons and isolation of patients, and even more because of good fortune and dedicated (indeed, heroic) medical personnel, it was contained and extinguished by July 2003. Quarantines, closure of factories and travel restrictions caused economic losses estimated at $40 billion worldwide, with an estimated 2.6% GDP loss in China, 1.05% GDP loss in Hong Kong, and 0.15% GDP loss to Canada34.

SARS is particularly dangerous to handle in the laboratory because there is no vaccine, so all laboratory workers are susceptible. It can be transmitted through aerosol/droplet mechanisms: the very large (321 cases) Amoy Gardens outbreak in Hong Kong was traced to infectious aerosols created by turbulent flushing water flow in the sewer lines: this turbulent flow generated aerosols that were sucked back up into numerous adjacent apartments through dry floor drains by negative pressure generated by bathroom exhaust fans! (Abraham 2005).

Moreover, about 5% of SARS patients are “super-spreaders” who pass the infection to many (over 8) secondary cases35. One case (ZZ) spread SARS to directly to 28 persons during one 18-hour hospitalization, before transfer to another hospital, where he infected 93 additional hospital personnel. At a third hospital he infected 23 staff and 19 patients, and at a fourth 20 hospital staff (Abraham 2005). Another super-spreader in Beijing infected at least 59 secondary cases. A super-spreader originally infected by ZZ in China visited Hong Kong but fell ill and remained in his hotel room, but managed to spread SARS to 10 secondary cases whose only associations were using a common elevator or hallway. These Hong Kong hotel exposures were international tourists, however, and were responsible for spreading SARS to Canada, Ireland, the US, Singapore, and Vietnam36. A 72-year old was already ill when he boarded flight CA112 from Hong Kong to Beijing on March 15, after having visited a niece ill with SARS in a Hong Kong hospital. Besides introducing another transmission chain in Beijing, on the two-hour flight he infected 20 other passengers and 2 flight attendants, who spread the disease to Mongolia, Singapore, Taiwan, and re-introduced new infection chains back into Hong Kong37 (Abraham 2005).  

The existence of SARS “super-spreaders” makes even a single laboratory infection into a potential pandemic.

SARS has not naturally recurred, but there have been six separate “escapes” from virology labs studying it: one each in Singapore and Taiwan, and in four distinct events at the same laboratory in Beijing.

The first escape was in Singapore in August 2003, in a 27-year-old virology graduate student at the National University of Singapore. He had not worked directly with SARS, but SARS was present in the virology laboratory where he worked with West Nile Virus (WNV). Investigation showed that his preparation of WNV was contaminated with SARS virus, and that this was the likely origin of his infection. After falling ill on Aug 26, he sought outpatient medical care in several venues, and was admitted to the hospital only on September 3. Fortunately he recovered and there were no secondary cases. Investigation revealed multiple shortcomings in infrastructure, training and observed procedures at the laboratory, and remedial actions were ordered38.

The second escape was in Taiwan in December 2003, when a SARS research scientist fell ill on a return airflight after attending a medical meeting in Singapore Dec 7-10. Although he felt his illness was SARS, he remained at home for 5 days, unwilling to seek medical care because he dreaded bringing disgrace to himself and his institution. He was only persuaded to enter the hospital when his father threatened to commit suicide39. Preliminary investigation implicated a laboratory exposure due to an attempt to decontaminate a bag of leaking biological waste, perhaps without proper protection and against protocol the day before he left for Singapore40. His 74 contacts in Singapore were put under quarantine for ten days, but again, fortunately none developed SARS. An expert committee from WHO investigated the laboratory and its procedures, and recommended improvements41.

This second outbreak further shook the virology communities in Asia, where many labs held and worked on SARS samples. On December 18, 2003 WHO released a new protocol for handling SARS specimens in the post-outbreak period, with special emphasis on reducing risk of and performing surveillance to detect laboratory infections42. Although this protocol was clearly created after the first (Singapore) escape, WHO chose to parse its words to avoid offending members. Perhaps distinguishing between a primary laboratory infection and secondary spread into a community “outbreak,” it chose to treat the risk as hypothetical, stating in the introduction:

“The possibility that a SARS outbreak could occur following a laboratory accident is a risk of considerable importance, given the relatively large number of laboratories currently conducting research using the SARS-CoV or retaining specimens from SARS patients. These laboratories currently represent the greatest threat for renewed SARS-CoV transmission through accidental exposure associated with breaches in laboratory biosafety.”


The hypothetical outbreak was not long in coming.

On April 22, 2004 China reported a suspected case of SARS in a 20-year-old nurse who fell ill April 5 in Beijing. The next day it reported she had nursed a 26-year-old female laboratory researcher who had fallen ill on March 25. Still ill, the researcher had traveled by train to her home in Anhui province where she was nursed by her mother, a physician, who fell ill on April 8 and died April 19. The researcher had worked at the Chinese National Institute of Virology (NIV) in Beijing, which is part of China’s Center for Disease Control (CDC), and which was a major center of SARS research. The investigation at NIV also uncovered an unrelated laboratory infection in a 31-year old male laboratory researcher at the NIV who fell ill on 17 April [43]. The entire NIV institute was closed and all of its 200 employees placed in quarantine in a hotel. Subsequent investigation confirmed these first three cases as SARS, and eventually identified a total of nine cases, in three generations, including health care workers and their family contacts44. Neither of the two primary patients had worked with live SARS virus, and WHO investigators had “serious concerns” regarding biosafety procedures at the NIV45.

Several Chinese and international groups investigated the outbreak at the NIV, and identified in retrospect two additional SARS laboratory infections at the NIV that had previously gone unrecognized and had begun in February 2004 [46]. A joint China CDC and WHO investigation found many shortcomings in biosecurity at the NIV, and traced the specific cause of the outbreak to an inadequately inactivated preparation of SARS virus that was used in general (not biosecure) laboratory areas in the NIV, including the one in which the two primary cases worked. It had not been tested to confirm its safety after inactivation, as it should have been. The WHO also found more general shortcomings in the handling of live SARS virus and a lack of surveillance of laboratory personnel for laboratory infections.

Li Liming, director of the China CDC and his deputy directory, the director of the NIV and his deputy director, and the director of the division where the two index cases worked were removed from their positions and found guilty of negligence in overseeing safety at the institution47. The Chinese government also decided to move the China CDC campus from its position in a residential neighborhood to an area “more remote from downtown,” and to allocate funds for more advanced laboratory equipment and infrastructure48.

Interestingly, the virology community is still reticent to discuss laboratory escapes: despite the considerable alarm these escapes created in the public health community and the participation of US CDC personnel in their investigation, they go unmentioned in the “10 years after” historical review of SARS by the CDC.49

-- Laboratory Escapes and “Self-fulfilling prophecy” Epidemics, by Martin Furmanski MD


But here's the point: SARS, Marburg, and Ebola viruses are not highly transmissible. So what you do is you get two or three people to get sick and die. Sometimes they go home and their neighbors get sick and die. But these are not yet pandemic viruses, because they don't have sufficient transmissibility, or they don't have sufficient infectivity, having to do with the number of human cells that they can infect. So that's why.

And that's what makes this completely different. By taking pandemic viruses using this gain of threat, so-called gain of function, but gain of threat to make them transmissible, we no longer have a problem with just laboratory workers getting ill and dying, which is terrible -- we don't want that -- but now we have a huge public health threat, as we can see with COVID-19, which I think was almost certainly created in a laboratory, certainly, probably created in a laboratory, and with the potential of something as horrific as the bird flu [60% mortality]. With these novel techniques, these novel experiments, we are now not just having viruses that have low transmissibility, even though they have high fatality, but rather ones that can create a huge public health problem.

And remember, they're novel. They're creating stuff that's never been created before through genetic engineering and animal experimentation. So our immune systems are not, like with COVID-19, we're not used to them. So now even the ones we've had before that we don't have any immunity to, that [research is] ongoing right now. And there's obviously a few researchers around the world who are making hundreds of millions of dollars eventually on funding. And they represent a problem. What we need is an international moratorium or ban on all gain of threat, gain of function, gain of threat research on potentially pandemic viruses. It's insane. Whatever value that research would provide, it can't possibly equal the threat.

You know Ralph, I think the public has not been in on this debate. It has been a secret debate with the NIH and other people who funded it. I think COVID-19 is a product of this. And I know Trump wants to call it the China virus. Well, the money that went into the creation and the genetic engineering of these coronaviruses in Wuhan was supported by the NIH and the USAID. So why wouldn't it be the NIH virus, or the USAID virus?

Ralph Nader: Well, because Trump delayed facing up to it, and kind of dismissed it, and has bungled, we call it the Trump virus now. It may have come from China, but apart from that, let's focus on something very controversial.

What's the source of the COVID-19 virus? The conventional explanation is it came from bats in live meat markets in Wuhan. and the bat bit a human and then it started to spread. That's the conventional approach.

Now, before we put the framework here, and before our listeners either say, "It's a conspiracy theory," or "Yes, they did come from the Wuhan Institute," contrary conclusions, I want to refer you to an article on Dr. Daniel Lucey, who is an infectious disease specialist at Georgetown University, [who] has huge experience around the world, has advised the World Health Organization, and really knows his stuff in past epidemics. And he was the subject of an article by the science writer of the New York Times on July 14th, William Broad. And he has eight questions that he always asks scientists to ask about any kind of epidemic. He's a student of epidemics. And the paragraph that's relevant to this discussion is as follows, and I'm quoting from the Times article. "The sixth and seventh questions go to whether the deadly pathogen leapt to humans from a laboratory. Although some intelligence analysts and scientists have entertained that scenario, no direct evidence has come to light suggesting that the coronavirus escaped from one of Wuhan's labs. Even so, given the wet market's downgrading in the investigation, quote, these are Dr. Lucey's words, "It is important to address questions about any potential laboratory source of the virus, whether in Wuhan or elsewhere," end quote, Dr. Lucey wrote in his blog post. That's one to frame the discussion.

For decades, Dr. Daniel R. Lucey, an infectious disease specialist at Georgetown University, has crisscrossed the globe to study epidemics and their origins. His attention now is on the Covid-19 pandemic, which first came to public notice late last year in Wuhan, China. Its exact beginnings are sufficiently clouded that the World Health Organization has begun a wide inquiry into its roots. The advance team is to leave for China this weekend, and Dr. Lucey has publicly encouraged the health agency to address what he considers eight top questions....

The sixth and seventh questions go to whether the deadly pathogen leapt to humans from a laboratory. Although some intelligence analysts and scientists have entertained that scenario, no direct evidence has come to light suggesting that the coronavirus escaped from one of Wuhan’s labs.

Even so, given the wet market’s downgrading in the investigation, “It is important to address questions about any potential laboratory source of the virus, whether in Wuhan or elsewhere,” Dr. Lucey wrote in his blog post.

To that end, he urges the W.H.O. investigators to look for any signs of “gain of function” research — the deliberate enhancement of pathogens to make them more dangerous. The technique is highly contentious. Critics question its merits and warn that it could lead to catastrophic lab leaks. Proponents see it as a legitimate way to learn how viruses and other infectious organisms might evolve to infect and kill people, and thus help in devising new protections and precautions.

Debate over its wisdom erupted in 2011 after researchers announced success in making the highly lethal H5N1 strain of avian flu easily transmissible through the air between ferrets, at least in the laboratory.


Prompted by controversy over dangerous research and recent laboratory accidents, the White House announced Friday that it would temporarily halt all new funding for experiments that seek to study certain infectious agents by making them more dangerous.

It also encouraged scientists involved in such research on the influenza, SARS and MERS viruses to voluntarily pause their work while its risks were reassessed.

Opponents of this type of research, called gain of function — for example, attempts to create a more contagious version of the lethal H5N1 avian influenza to learn which mutations made it that way — were elated.

“Brilliant!” said Peter Hale, the executive director of the Foundation for Vaccine Research, which opposes such experiments. “The government has finally seen the light. This is what we have all been waiting for and campaigning for. I shall sleep better tonight.”  

The announcement, which was made by the White House Office of Science and Technology Policy and the Department of Health and Human Services, did not say how long the moratorium would last. It said a “deliberative process to assess the potential risks and benefits” would begin this month and stretch at least into next year.

The move appeared to be a sudden change of heart by the Obama administration, which last month issued regulations calling for more stringent federal oversight of such research and requiring scientists and universities to disclose that their work might be risky, rather than expecting federal agencies to notice.

Critics at the time dismissed those rules as too weak.

The moratorium is only on research on influenza virus and the coronaviruses that cause SARS and MERS. It made no mention of Ebola or any related filovirus. Ebola is already extremely lethal, but it is not easily transmissible.

No scientist has publicly announced an attempt to make Ebola as easy to transmit with a sneeze as flu is. Given the current panic around Ebola, and congressional anger at federal health agencies, it is unlikely that federal funding for such a project would be given out.

The debate over the wisdom of “gain of function” research erupted in 2011 when the labs of Ron Fouchier of Erasmus University in the Netherlands, and Yoshihiro Kawaoka of the University of Wisconsin-Madison, separately announced that they had succeeded in making the lethal H5N1 avian flu easily transmissible between ferrets, which are a model for human susceptibility to flu.

The debate heated up further this year when the Centers for Disease Control and Prevention admitted it had suffered laboratory accidents that exposed dozens of workers to anthrax and shipped deadly avian flu virus to another federal lab that had asked for a more benign flu strain. Also this year, vials of smallpox that had been forgotten for 50 years were found in a lab at the National Institutes of Health.

The White House said the moratorium decision had been made “following recent biosafety incidents at federal research facilities.”


Dr. Kawaoka said he would not start any new gain-of-function experiments and would consult with the N.I.H. about which ones he had underway that met their criteria for the moratorium.

Many scientists were furious that such work had been permitted and even supported with American tax dollars. But others argued that it was necessary to learn which genetic mutations make viruses more dangerous. If those mutations began appearing naturally as the viruses circulated in animals and people, warnings could be issued and vaccines designed, they said.

Some scientists argued that the two scientists should not be permitted to publish all the details of their experiments, for fear that terrorists or unscrupulous scientists would duplicate them and start a fatal pandemic.

Others, like Richard H. Ebright, a molecular biologist and bioweapons expert at Rutgers University, argued that the long history of accidental releases of infectious agents from research labs made such work extremely risky and unwise to perform in the first place.


Dr. Ebright called Friday’s announcement “an important, albeit overdue, step.”

Michael T. Osterholm, director of the Center for Infectious Disease Research and Policy at the University of Minnesota, called the moratorium “a wise move — I congratulate the U.S. government on taking this step.”

The new policy had to be announced now, he explained, because the National Science Advisory Board for Biosecurity is to meet later this month. It will have 11 new members, and gain of function research is a principal agenda item.

Dr. Osterholm was one of 11 previous members who were removed from the board in the middle of the controversy.

All, like him, had been on it many years past their original five-year appointments and were due to be replaced, but had routinely been asked to stay, he said.

In April, he was the author of a letter to the National Institutes of Health complaining about government pressure on the advisory board. The institutes gave grants to support gain of function work.

The explanation given was that they had outlasted their tenures, but Dr. Osterholm said that “in the same week as the anthrax accident at the C.D.C., we all got an email on a Sunday night from a junior staffer telling us we were out.”

He called that a public relations failure: “P.R. zero point zero.”

-- White House to Cut Funding for Risky Biological Study, by Donald G. McNeil Jr., NYT, Oct. 17, 2014


In his blog, Dr. Lucey asks “what, if any,” gain-of-function studies were done on coronaviruses in Wuhan, elsewhere in China, or in collaboration with foreign laboratories.

“If done well scientifically, then this investigation should allay persistent concerns about the origin of this virus,” he wrote. “It could also help set an improved standard for investigating and stopping the awful viruses, and other pathogens, in the decades ahead.”

Finally, Dr. Lucey asks the W.H.O. team to learn more about China’s main influenza research lab, a high-security facility in Harbin, the capital of China’s northernmost province. In May, he notes, a Chinese paper in the journal Science reported that two virus samples from Wuhan were studied there in great detail early this year, including in a variety of animals. It reported that cats and ferrets were highly susceptible to the pathogen; dogs were only mildly susceptible; and pigs, chickens and ducks were not susceptible at all.


-- 8 Questions From a Disease Detective on the Pandemic’s Origins: Dr. Daniel R. Lucey wants answers to pointed questions that bear on how the coronavirus leapt from bats to humans, by William J. Broad, NYT, July 8, 2020
 
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 9:32 am

Part 2 of 2

Second, there is an article in the Mother Jones [“The Non-paranoid Person’s Guide to Viruses Escaping from Labs”] on the virus situation. And in the article, by Rowan Jacobsen, J-A-C-O-B-S-E-N, it says, and I'm quoting,

"It's doubtful we'll ever pinpoint COVID-19's origins. Despite many experts' skepticism, no one I talked to said they could confidently rule out the possibility that it accidentally escaped from a lab that was studying it. But it also could have been carried to Wuhan by someone who was infected elsewhere, or by an animal that served as an intermediate host. Yet it may turn out for the best that the Wuhan lab is now in the news. Most people don't realize how heroic some of its work was or how it could have helped to head off the next pandemic."

In all the discussions of the origin of the COVID-19 pandemic, enormous scientific attention has been paid to the molecular character of the SARS-CoV-2 virus, including its novel genome sequence in comparison with its near relatives. In stark contrast, virtually no attention has been paid to the physical provenance of those nearest genetic relatives, its presumptive ancestors, which are two viral sequences named BtCoV/4991 and RaTG13.

This neglect is surprising because their provenance is more than interesting. BtCoV/4991 and RaTG13 were collected from a mineshaft in Yunnan province, China, in 2012/2013 by researchers from the lab of Zheng-li Shi at the Wuhan Institute of Virology (WIV). Very shortly before, in the spring of 2012, six miners working in the mine had contracted a mysterious illness and three of them had died (Wu et al., 2014). The specifics of this mystery disease have been virtually forgotten; however, they are described in a Chinese Master’s thesis written in 2013 by a doctor who supervised their treatment.

We arranged to have this Master’s thesis translated into English. The evidence it contains has led us to reconsider everything we thought we knew about the origins of the COVID-19 pandemic. It has also led us to theorise a plausible route by which an apparently isolated disease outbreak in a mine in 2012 led to a global pandemic in 2019...

We do not propose a specifically genetically engineered or biowarfare origin for the virus but the theory does propose an essential causative role in the pandemic for scientific research carried out by the laboratory of Zheng-li Shi at the WIV; thus also explaining Wuhan as the location of the epicentre.

Why has the provenance of RaTG13 and BtCoV/4991 been ignored?

The apparent origin of the COVID-19 pandemic is the city of Wuhan in Hubei province, China. Wuhan is also home to the world’s leading research centre for bat coronaviruses. There are two virology labs in the city, both have either collected bat coronaviruses or researched them in the recent past. The Shi lab, which collected BtCoV/4991 and RaTG13, recently received grants to evaluate by experiment the potential for pandemic pathogenicity of the novel bat coronaviruses they collected from the wild.

To add to these suggestive data points, there is a long history of accidents, disease outbreaks, and even pandemics resulting from lab accidents with viruses (Furmanski, 2014; Weiss et al., 2015)....

As we detailed in our previous article, in their search for SARS-like viruses with zoonotic spillover potential, researchers at the WIV have passaged live bat viruses in monkey and human cells (Wang et al., 2019). They have also performed many recombinant experiments with diverse bat coronaviruses (Ge et al., 2013; Menachery et al., 2015; Hu et al., 2017). Such experiments have generated international concern over the possible creation of potential pandemic viruses (Lipsitch, 2018). As we showed too, the Shi lab had also won a grant to extend that work to whole live animals. They planned “virus infection experiments across a range of cell cultures from different species and humanized mice” with recombinant bat coronaviruses. Yet Andersen et al did not discuss this research at all, except to say:

“Basic research involving passage of bat SARS-CoV-like coronaviruses in cell culture and/or animal models has been ongoing for many years in biosafety level 2 laboratories across the world”

This statement is fundamentally misleading about the kind of research performed at the Shi lab....

BtCoV/4991 was first described in 2016. It is a 370 nucleotide virus fragment collected from the Mojiang mine in 2013 by the lab of Zeng-li Shi at the WIV [Wuhan Institute of Virology] (Ge et al., 2016). BtCoV/4991 is 100% identical in sequence to one segment of RaTG13. RaTG13 is a complete viral genome sequence (almost 30,000 nucleotides) that was only published in 2020, after the pandemic began (P. Zhou et al., 2020).

Despite the confusion created by their different names, in a letter obtained by us Zheng-li Shi confirmed to a virology database that BtCoV/4991 and RaTG13 are both from the same bat faecal sample and the same mine. They are thus sequences from the same virus. In the discussion below we will refer primarily to RaTG13 and specify BtCoV/4991 only as necessary.

These specifics are important because it is these samples and their provenance that we believe are ultimately key to unravelling the mystery of the origins of COVID-19.

The story begins in April 2012 when six workers in that same Mojiang mine fell ill from a mystery illness while removing bat faeces. Three of the six subsequently died.

In a March 2020 interview with Scientific American Zeng-li Shi dismissed the significance of these deaths, claiming the miners died of fungal infections. Indeed, no miners or deaths are mentioned in the paper published by the Shi lab documenting the collection of RaTG13 (Ge et al., 2016).

But Shi’s assessment does not tally with any other contemporaneous accounts of the miners and their illness (Rahalkar and Bahulikar, 2020). As these authors have pointed out, Science magazine wrote up part of the incident in 2014 as A New Killer Virus in China?. Science was citing a different team of virologists who found a paramyxovirus in rats from the mine. These virologists told Science they found “no direct relationship between human infection” and their virus. This expedition was later published as the discovery of a new virus called MojV after Mojiang, the locality of the mine (Wu et al., 2014).

What this episode suggests though is that these researchers were looking for a potentially lethal virus and not a lethal fungus. Also searching the Mojiang mine for a [potentially lethal] virus at around the same time was Canping Huang, the author of a PhD thesis carried out under the supervision of George Gao, the head of the Chinese CDC.

All of this begs the question of why the Shi lab, which has no interest in fungi but a great interest in SARS-like bat coronaviruses, also searched the Mojiang mine for bat viruses on four separate occasions between August 2012 and July 2013, even though the mine is a 1,000 Km from Wuhan (Ge et al., 2016). These collecting trips began while some of the miners were still hospitalised.

Fortunately, a detailed account of the miner’s diagnoses and treatments exists. It is found in a Master’s thesis written in Chinese in May 2013. Its suggestive English title is “The Analysis of 6 Patients with Severe Pneumonia Caused by Unknown viruses“.

The original English version of the abstract implicates a SARS-like coronavirus as the probable causative agent and that the mine “had a lot of bats and bats’ feces”...

The significance of the Master’s thesis

These findings of the thesis are significant in several ways.

First, in the light of the current coronavirus pandemic it is evident the miners’ symptoms very closely resemble those of COVID-19 (Huang et al, 2020; Tay et al., 2020; M. Zhou et al., 2020). Anyone presenting with them today would immediately be assumed to have COVID-19. Likewise, many of the treatments given to the miners have become standard for COVID-19 (Tay et al., 2020).

Second, the remote meeting with Zhong Nanshan is significant. It implies that the illnesses of the six miners were of high concern and, second, that a SARS-like coronavirus was considered a likely cause.

Third, the abstract, the conclusions, and the general inferences to be made from the Master’s thesis contradict Zheng-li Shi’s assertion that the miners died from a fungal infection. Fungal infection as a potential primary cause was raised but largely discarded.

Fourth, if a SARS-like coronavirus was the source of their illness the implication is that it could directly infect human cells. This would be unusual for a bat coronavirus (Ge et al., 2013). People do sometimes get ill from bat faeces but the standard explanation is histoplasmosis, a fungal infection and not a virus (McKinsey and McKinsey, 2011; Pan et al., 2013).

Fifth, the sampling by the Shi lab found that bat coronaviruses were unusually abundant in the mine (Ge at al., 2016). Among their findings were two betacoronaviruses, one of which was RaTG13 (then known as BtCoV/4991). In the coronavirus world betacoronaviruses are special in that both SARS and MERS, the most deadly of all coronaviruses, are both betacoronaviruses. Thus they are considered to have special pandemic potential, as the concluding sentence of the Shi lab publication which found RaTG13 implied: “special attention should particularly be paid to these lineages of coronaviruses” (Ge at al., 2016). In fact, the Shi and other labs have for years been predicting that bat betacoronaviruses like RaTG13 would go pandemic; so to find RaTG13 where the miners fell ill was a scenario in perfect alignment with their expectations....

it now seems that the Shi lab at the WIV did not forget about RaTG13 but were sequencing its genome in 2017 and 2018. However, we believe that the Master’s thesis indicates a much simpler explanation.

We suggest, first, that inside the miners RaTG13 (or a very similar virus) evolved into SARS-CoV-2, an unusually pathogenic coronavirus highly adapted to humans. Second, that the Shi lab used medical samples taken from the miners and sent to them by Kunming University Hospital for their research. It was this human-adapted virus, now known as SARS-CoV-2­, that escaped from the WIV in 2019....

The Master’s thesis also states its regret that no samples for research were taken from patients 1 and 2, implying that samples were taken from all the others.

We further know that, on June 27th, 2012, the doctors performed an unexplained thymectomy on patient 4. The thymus is an immune organ that can potentially be removed without greatly harming the patient and it could have contained large quantities of virus. Beyond this the Master’s thesis is unfortunately unclear on the specifics of what sampling was done, for what purpose, and where each particular sample went.

Given the interests of the Shi lab in zoonotic origins of human disease, once such a sample was sent to them, it would have been obvious and straightforward for them to investigate how a virus from bats had managed to infect these miners. Any viruses recoverable from the miners would likely have been viewed by them as a unique natural experiment in human passaging offering unprecedented and otherwise-impossible-to-obtain insights into how bat coronaviruses can adapt to humans.

The logical course of such research would be to sequence viral RNA extracted directly from unfrozen tissue or blood samples and/or to generate live infectious clones for which it would be useful (if not imperative) to amplify the virus by placing it in human cell culture. Either technique could have led to accidental infection of a lab researcher.

Our supposition as to why there was a time lag between sample collection (in 2012/2013) and the COVID-19 outbreak is that the researchers were awaiting BSL-4 lab construction and certification, which was underway in 2013 but delayed until 2018.

We propose that, when frozen samples derived from the miners were eventually opened in the Wuhan lab they were already highly adapted to humans to an extent possibly not anticipated by the researchers. One small mistake or mechanical breakdown could have led directly to the first human infection in late 2019.

Thus, one of the miners, most likely patient 3, or patient 4 (whose thymus was removed), was effectively patient zero of the COVID-19 epidemic. In this scenario, COVID-19 is not an engineered virus; but, equally, if it had not been taken to Wuhan and no further molecular research had been performed or planned for it then the virus would have died out from natural causes, rather than escaped to initiate the COVID-19 pandemic....

Further questions

The hypothesis that SARS-CoV-2 evolved in the Mojiang miner’s lungs potentially resolves many scientific questions about the origin of the pandemic. But it raises others having to do with why this information has not come to light hitherto. The most obvious of these concern the actions of the Shi lab at the WIV.

Why did the Shi lab not acknowledge the miners’ deaths in any paper describing samples taken from the mine (Ge et al., 2016 and P. Zhou et al., 2020)? Why in the title of the Ge at al. 2016 paper did the Shi lab call it an “abandoned” mine? When they published the sequence of RaTG13 in Feb. 2020, why did the Shi lab provide a new name (RaTG13) for BtCoV/4991 when they had by then cited BtCoV/4991 twice in publications and once in a genome sequence database and when their sequences were from the same sample and 100% identical (P. Zhou et al., 2020)? If it was just a name change, why no acknowledgement of this in their 2020 paper describing RaTG13 (Bengston, 2020)? These strange and unscientific actions have obscured the origins of the closest viral relatives of SARS-CoV-2, viruses that are suspected to have caused a COVID-like illness in 2012 and which may be key to understanding not just the origin of the COVID-19 pandemic but the future behaviour of SARS-CoV-2.

These are not the only questionable actions associated with the provenance of samples from the mine. There were five scientific publications that very early in the pandemic reported whole genome sequences for SARS-CoV-2 (Chan et al., 2020; Chen et al., 2020; Wu et al., 2020; P. Zhou et al., 2020; Zhu et al., 2020). Despite three of them having experienced viral evolutionary biologists as authors (George Gao, Zheng-li Shi and Edward Holmes) only one of these (Chen et al., 2020) succeeded in identifying the most closely related viral sequence by far: BtCoV/4991 a viral sequence in the possession of the Shi lab at the WIV that differed from SARS-CoV-2 by just 5 nucleotides.  

-- A Proposed Origin for SARS-CoV-2 and the COVID-19 Pandemic, by Jonathan Latham, PhD and Allison Wilson, PhD


"They also haven't grasped the danger posed by the work being done at high-security biolabs around the world. Yet, the next pandemic could start from a lab in China. But it could just as easily come from our own backyard. In recent decades, more diseases have been jumping from animals to humans, a phenomenon called zoonotic spillover. Experts blame our increasing incursions into the natural world. As we convert forests to farms and hunt wild animals, we give viruses new opportunities for spillover."

Now, Andrew, you are a lawyer and you're a litigator, correct?

Andrew Kimbrell: Yes.

Ralph Nader: Okay. So you know the difference between plausibility and probative evidence. Tell our listeners the difference.

Andrew Kimbrell: Well, I think that there is plausibility, but I would switch it to preponderance of the evidence. Quite often in civil trials you only have circumstantial evidence, and some scientific evidence, but you don't have sufficient evidence to say beyond a reasonable doubt. You have to say, "Listen, this is the cause, this did it, we got it, here's the gun, here's how it happened," but you have circumstantial evidence. So you have a preponderance of the ‘which is more likely.’ And that's all we can do right now with this is say, "Which is more likely? Is it more likely with this chimeric virus, that some bat met a pangolin in a bar in Wuhan and with a human, and somehow all that happened?" We know the wet market has been debunked. The Chinese government has debunked it; science has debunked it. So we got to get rid of these wet markets; they are horror shows; they're unethical; they hurt wildlife; we should all get together and close every wet market there is around there; it's terrible. But it didn't create COVID-19. No respectable scientist now says it did. The bat soup, bat bite theory is dead. And there is no other tangible theory. How did one animal get simultaneously infected by two or three other animals that had the unique capacity that COVID-19 has?

There's a very important article by Nikolai Petrovsky, one of the most highly respected vaccine scientists in the world, that came out in late May in Science Times. He and his team in Australia had done comprehensive surveys, looking at all the animals they could find, and there wasn't a single animal out there that could serve as the reservoir for this. And he said, this virus was exquisitely designed to be infective to humans, and completely unlike any virus they had known.

An extremely important but still unanswered question is what was the original source of the COVID-19 virus. While SARS-CoV-2 has some similarities to SARS CoV and other bat viruses, no natural virus matching to COVID-19 has yet been found in animals. Our group at Flinders University in collaboration with researchers at La Trobe University have used a modelling approach to study the possible evolutionary origins of COVID-19 by modelling interactions between its spike protein and a broad variety of ACE2 receptors from animals and humans. This work which has been made available on a prepress server, Arxiv and is downloadable at http://arxiv.org/abs/2005.06199 shows that the strength of binding of COVID-19 to human ACE2 exceeds the predicted strength of binding to ACE2 of the other tested species, with pangolin ACE2 having the next highest affinity.

The devastating impact of the COVID-19 pandemic caused by SARS–coronavirus 2 (SARSCoV-2) has raised important questions on the origins of this virus, the mechanisms of any zoonotic transfer from exotic animals to humans, whether companion animals or those used for commercial purposes can act as reservoirs for infection, and the reasons for the large variations in SARS-CoV-2 susceptibilities across animal species. Traditional lab-based methods will ultimately answer many of these questions but take considerable time. Increasingly powerful in silico modeling methods provide the opportunity to rapidly generate information on newly emerged pathogens to aid countermeasure development and also to predict potential future behaviors. We used an in silico structural homology modeling approach to characterize the SARS-CoV-2 spike protein which predicted its high affinity binding to the human ACE2 receptor. Next we sought to gain insights into the possible origins and transmission path by which SARS-CoV-2 might have crossed to humans by constructing models of the ACE2 receptors of relevant species, and then calculating the binding energy of SARS-CoV-2 spike protein to each of these. Notably, SARS-CoV-2 spike protein had the highest overall binding energy for human ACE2, greater than all the other tested species including bat, the postulated source of the virus. This indicates that SARS-CoV-2 is a highly adapted human pathogen. Of the species studied, the next highest binding affinity after human was pangolin, which is most likely explained by a process of convergent evolution. Binding of SARS-CoV-2 for dog and cat ACE2 was similar to affinity for bat ACE2, all being lower than for human ACE2, and is consistent with only occasional observations of infections of these domestic animals. Snake ACE2 had low affinity for spike protein, making it highly improbable that snakes acted as an intermediate vector. Overall, the data indicates that SARS-CoV-2 is uniquely adapted to infect humans, raising important questions as to whether it arose in nature by a rare chance event or whether its origins might lie elsewhere.

-- In silico comparison of spike protein-ACE2 binding affinities across species; significance for the possible origin of the SARS-CoV-2 virus, by Sakshi Piplani, Puneet Kumar Singh, David A. Winkler, Nikolai Petrovsky


This high binding to human ACE2 suggests the possibility that the COVID-19 spike protein has previously undergone selection on human ACE2 or a closely related ACE2 variant. How this might have happened is currently unknown and warrants further scientific investigation.

-- Nikolai Petrovsky, Professor in the College of Medicine and Public Health at Flinders University and Research Director, Vaxine Pty Ltd in "The Case is Building That COVID-19 Had a Lab Origin, by Jonathan Latham, Ph.D. and Allison Wilson, Ph.D.


Ralph Nader: First of all, just to clarify for our listeners, you're saying there's a preponderance of the evidence that it accidentally was leaked from the lab. You're not saying deliberate, right?

Andrew Kimbrell: No. No. I don't think it was deliberately released. And by the way, for the folks out there, I really get it that we all need to be worried about biological weapons research. We know it's going on in China. We know it's still going on in the US, and almost certainly going on in Russia. So I don't want to give, anymore than I want to give the wet markets a pass, I don't want to give biological weapons research a pass. It's a huge danger, a bio-security danger to us as well. However, it is highly, probably unlikely that COVID-19 would ever be a bio weapon [because] it would boomerang. It's highly infectious in humans. It would boomerang on your own population. It would make no sense. So, yes, accidental release, not deliberate release, a product of genetic engineering that took a SARS-like virus and they wanted to see how transmissible they could make it; they wanted to see how lethal they could make it, and it escaped.


Ralph Nader: I have to question your science, because I've heard on the radio and read in the media where there are scientists who say it came from animals. And the fact is there was a very respectable scientist in Wuhan who completely dismissed the leak from the lab, and said it was zoonotically or sourced in animal transmission. That doesn't mean that's the case, Andy. It just . . .

Andrew Kimbrell: Ralph, no. I said that the wet market hypothesis, the one you mentioned, the one that was popular in the media, has been completely debunked. They still say it could have been natural, some other animals could have done it, but there is no real scenario for that.

But here is what I want to point out. I don't want to get lost in this discussion, because this is where everyone gets lost, and it defeats the purpose of why I'm on your show today. I'm not concerned with proving one thing or the other. Shi Zhengli, who is the bat woman, who is director of the Wuhan Institute of Virology’s [Center for Emerging Infectious Diseases], said when she heard and saw the virus going out there, and she saw the pandemic, she didn't sleep a wink for days she was so afraid. This is her saying, "I didn't sleep a wink for days." She said, "I was afraid that that virus had come from my lab."

Shi Zhengli, a deputy director of the institute, told the press in February that she 'guaranteed with her own life' that the outbreak was not related to the lab.

She admits that when summoned back from a conference to investigate the new disease, she wondered at first if a coronavirus could have escaped from her unit.

She has warned about the danger of epidemics from bat-borne viruses.

But she says she did not expect such an outbreak in Wuhan, in the center of China, since her studies suggested subtropical areas in the south had the highest risk of such 'zoonotic' transmission to humans.

Shi told the respected science journal Scientific American last month of her relief when, having checked back through disposal records, none of the genome sequences matched their virus samples.

'That really took a load off my mind. I had not slept a wink for days,' she said.

-- U.S. government gave $3.7 million grant to Wuhan lab at center of coronavirus leak scrutiny that was performing experiments on bats from the caves where the disease is believed to have originated, by Frances Mulraney and Glenn Owen


So we don't need a lot of people saying what's possible. I said Petrovsky, and you mentioned Lacey, and Jonathan Latham has an excellent article on this. I recommend everyone read the Bulletin of the Atomic Scientists on June 4th with Milton Leitenberg's excellent and very well-researched analysis so you can make your own decision about whether you think it was lab or natural. The most important thing is that the woman who actually was the head of that gain of threat research, funded by the NIH for five years, said she was so afraid she couldn't sleep a wink, Ralph.

Ralph Nader: You say she couldn't sleep at night, but what is her position right now?

Andrew Kimbrell: Her position is she looked through all of her viruses, and she said this was not one of them. Now, of course, we don't have those records. And maybe she's right, and maybe she's wrong. But the point I'm trying to make here is that it could have happened. If this gain of research could have been a cause, there's a reasonable belief that it could have been a cause, and there are scientists across the board -- you mentioned several, and I mentioned several, including her -- who said that she was so afraid that her research had caused it, that she couldn't sleep. That's all I care about. That means that this research is admittedly something that could create the next pandemic. This gain of threat research could create new pandemic viruses. Fouchier is doing it in the Netherlands with NIH money. Kawaoka is doing it at the University of Wisconsin. And there are many, many other scientists, including Shi Zhengli in China, who are still doing it. That means they agree that this could be the source of a new pandemic that could be even worse than we're seeing now. That's the only answer we need.

Ralph Nader: What's the suggestion for further investigations? Where? Who?

Andrew Kimbrell: We don't need further investigation, unless you want to try and prove it one way or the other. And China probably will never release any records they have from that laboratory. And China has actively destroyed a huge amount of evidence that is in the public record. I'm saying what we need now is to say that research on vaccines is great, go for it; and viral research, go for it. Lots of research is really important. But we need to reinstate the 2014 Obama moratorium on this gain of threat research, potential pandemic viruses. It represents an existential threat to the human population. It's providing little or zero help in any vaccine.

And again, I rely on Marc Lipsitch, and Tom Inglesby and Richard Ebright, the top scientists in the field who have said exactly what I'm saying.

Richard Ebright, an infectious disease expert at Rutgers, put it more bluntly. "The PREDICT program has produced no results—absolutely no results—that are of use for preventing or combating outbreaks. There's no information from that project that will contribute in any way, shape or form to addressing the outbreak at hand. The research does not provide information that's useful for developing antiviral drugs. It does not provide information that's useful for developing vaccines."

-- The Controversial Experiments and Wuhan Lab Suspected of Starting the Coronavirus Pandemic, by Fred Guterl, Naveed Jamali and Tom O'Connor


And Marc Lipsitch, at Harvard, epidemiology specialist at Harvard, has said that for every year that they work on one of these pandemic viruses with this gain of threat, engineering animal research, there's a 1 in 1000 chance of an accidental escape from the lab. This has not been part of the public debate. We've debated nuclear weapons; we've debated other GMOs; but we have not said we need a moratorium, a multi-year moratorium, hopefully a ban, on genetically engineering these potential pandemic viruses, when they're providing us almost no medical benefit. So that's the key that we need to focus on rather than back and forth, or using it as anti-China or Trump. That's the hidden forest that we need to look at, and not get so obsessed with the trees.

Ralph Nader: Fair enough, but the support for what you're recommending, a moratorium, will be much greater if there are any whistleblowers that provide documented evidence out of the Wuhan Institute. Then it becomes really a high-level visible change and moratorium. So do you see any possibility of that?

Andrew Kimbrell: Yeah, the case is building. I mean that's what Jonathan Latham's article says, and what Petrovsky is saying. The case is building.

But I will just point out that hundreds of scientists came together in 2014 to get this moratorium done. It's really unusual to have a moratorium on research and science. And they got it done in 2014 because of the fear of this bird flu research that was being done, that could lead to this fantastic, horrifying pandemic of 1.6 billion people dying. Well, that's still out there. And so I find it a little shocking that these experiments were approved in secret a little over a year ago, reapproved after they lifted the moratorium, and that there's no public debate about that.

Ten years ago, the viral pathogen most in the news was not a coronavirus but influenza—in particular, a strain of flu, designated H5N1, that arose in birds and killed a high proportion of those who were infected. For a while, the virus made headlines. Then it became clear that nearly everyone who caught the bird-flu virus got it directly from handling birds. To cause a plague, it's not enough that a virus is an efficient killer. It also has to pass easily from one person to the next, a quality called transmissibility.

Around this time, Ron Fouchier, a scientist at Erasmus University in Holland, wondered what it would take for the bird flu virus to mutate into a plague virus. The question was important to the mission of virologists in anticipating human pandemics. If H5N1 were merely one or two steps away from acquiring human transmissibility, the world was in danger: a transmissible form of H5N1 could quickly balloon into a devastating pandemic on the order of the 1918 flu, which killed tens of millions of people.

To answer the question, scientists would have to breed the virus in the lab in cell cultures and see how it mutated. But this kind of work was difficult to carry out and hard to draw conclusions from. How would you know if the end result was transmissible?

The answer that Fouchier came up with was a technique known as "animal passage," in which he mutated the bird-flu virus by passing it through animals rather than cell cultures. He chose ferrets because they were widely known as a good stand-in for humans—if a virus can jump between ferrets, it is likely also to be able to jump between humans. He would infect one ferret with a bird-flu virus, wait until it got sick, and then remove a sample of the virus that had replicated in the ferret's body with a swab. As the virus multiplies in the body, it mutates slightly, so the virus that came out of the ferret was slightly different from the one that went into it. Fouchier then proceeded to play a version of telephone: he would take the virus from the first ferret and infect a second, then take the mutated virus from the second ferret and infect a third, and so on.

After passing the virus through 10 ferrets, Fouchier noticed that a ferret in an adjacent cage became ill, even though the two hadn't come into contact with one another. That showed that the virus was transmissible in ferrets—and, by implication, in humans. Fouchier had succeeded in creating a potential pandemic virus in his lab.

When Fouchier submitted his animal-passage work to the journal Science in 2011, biosecurity officials in the Obama White House, worried that the dangerous pathogen could accidentally leak from Fouchier's lab, pushed for a moratorium on the research. Fouchier had done his work in BSL-2 labs, which are intended for pathogens such as staph, of moderate severity, rather than BSL-4, which are intended for Ebola and similar viruses. BSL-4 labs have elaborate safeguards—they're usually separate buildings with their own air circulation systems, airlocks and so forth. In response, the National Institutes of Health issued a moratorium on the research.

What followed was a fierce debate among scientists over the risks versus benefits of the gain-of-function research. Fouchier's work, wrote Harvard epidemiologist Marc Lipsitch in the journal Nature in 2015, "entails a unique risk that a laboratory accident could spark a pandemic, killing millions.

Lipsitch and 17 other scientists had formed the Cambridge Working Group in opposition. It issued a statement pointing out that lab accidents involving smallpox, anthrax and bird flu in the U.S. "have been accelerating and have been occurring on average over twice a week."

"Laboratory creation of highly transmissible, novel strains of dangerous viruses... poses substantially increased risks," the statement said. "An accidental infection in such a setting could trigger outbreaks that would be difficult or impossible to control. Historically, new strains of influenza, once they establish transmission in the human population, have infected a quarter or more of the world's population within two years." More than 200 scientists eventually endorsed the position.

The proponents of gain-of-function research were just as passionate. "We need GOF experiments," wrote Fouchier in Nature, "to demonstrate causal relationships between genes or mutations and particular biological traits of pathogens. GOF approaches are absolutely essential in infectious disease research."

The NIH eventually came down on the side of Fouchier and the other proponents. It considered gain-of-function research worth the risk it entailed because it enables scientists to prepare anti-viral medications that could be useful if and when a pandemic occurred.

By the time NIH lifted the moratorium, in 2017, it had granted dozens of exceptions. The PREDICT program, started in 2009, spent $200 million over 10 years, sending virologists all over the world to look for novel viruses and support some gain-of-function research on them. The program ran out of funding in 2019 and was then extended.

-- The Controversial Experiments and Wuhan Lab Suspected of Starting the Coronavirus Pandemic, by Fred Guterl, Naveed Jamali and Tom O'Connor


Ralph Nader: Does Trump know about this?

Andrew Kimbrell: I have no idea what he knows ...

Ralph Nader: Because it's under his ...

Andrew Kimbrell: His capacity to take in information seems to me extremely limited since he doesn't read and ...

Ralph Nader: Let's put it this way. Since it was under his regime that this occurred, the reintroduction of this kind of research, does the White House know about this?

Andrew Kimbrell: Well, Fauci and Francis Collins were supportive of this kind of research. They were not obviously in favor of the moratorium.

A decade ago, during a controversy over gain-of-function research on bird-flu viruses, Dr. Fauci played an important role in promoting the work. He argued that the research was worth the risk it entailed because it enables scientists to make preparations, such as investigating possible anti-viral medications, that could be useful if and when a pandemic occurred.

The work in question was a type of gain-of-function research that involved taking wild viruses and passing them through live animals until they mutate into a form that could pose a pandemic threat. Scientists used it to take a virus that was poorly transmitted among humans and make it into one that was highly transmissible—a hallmark of a pandemic virus. This work was done by infecting a series of ferrets, allowing the virus to mutate until a ferret that hadn't been deliberately infected contracted the disease.

The work entailed risks that worried even seasoned researchers. More than 200 scientists called for the work to be halted. The problem, they said, is that it increased the likelihood that a pandemic would occur through a laboratory accident.

Dr. Fauci defended the work. "[D]etermining the molecular Achilles' heel of these viruses can allow scientists to identify novel antiviral drug targets that could be used to prevent infection in those at risk or to better treat those who become infected," wrote Fauci and two co-authors in the Washington Post on December 30, 2011. "Decades of experience tells us that disseminating information gained through biomedical research to legitimate scientists and health officials provides a critical foundation for generating appropriate countermeasures and, ultimately, protecting the public health."

Nevertheless, in 2014, under pressure from the Obama administration, the National of Institutes of Health instituted a moratorium on the work, suspending 21 studies.

Three years later, though—in December 2017—the NIH ended the moratorium and the second phase of the NIAID project, which included the gain-of-function research, began. The NIH established a framework for determining how the research would go forward: scientists have to get approval from a panel of experts, who would decide whether the risks were justified.

The reviews were indeed conducted—but in secret, for which the NIH has drawn criticism. In early 2019, after a reporter for Science magazine discovered that the NIH had approved two influenza research projects that used gain of function methods, scientists who oppose this kind of research excoriated the NIH in an editorial in the Washington Post.

"We have serious doubts about whether these experiments should be conducted at all," wrote Tom Inglesby of Johns Hopkins University and Marc Lipsitch of Harvard. "[W]ith deliberations kept behind closed doors, none of us will have the opportunity to understand how the government arrived at these decisions or to judge the rigor and integrity of that process."

-- Dr. Fauci Backed Controversial Wuhan Lab with U.S. Dollars for Risky Coronavirus Research, by Fred Guterl


So there was enough scientific angst about what was going on. But again, I think that we argue, we see these nuclear treaties going down the drain, and these are really existential threats to us. But we don't think of this genetic engineering of these pandemic viruses that are ongoing in these labs as threats, especially since there has been this total failure to have a strong biosecurity international effort. This is something we have to work together on. I'm certainly going to be working on it. We're going to Congress to try and get bipartisan agreement to get a moratorium or a ban on this kind of research in COVID, because we don't have to prove that gain-of-threat research didn't create it, we just have to show, as so many scientists have, that it is either probable or even just possible. That is enough. The Nuremberg Code said very explicitly that you should never do research whose threat to the public is greater than the advantage that you're getting. And this seems to me clearly an example of that. Additionally, there's a similar code in the InterAcademy Partnership [a global network], and I'm going to read it to you. This is the code that's supposed to be the ethics behind all biomedical research. And it says,

"Scientists have an obligation to do no harm. They need to take into consideration the reasonably foreseeable consequences of their own activities."


Well, this kind of research obviously violates that. It's just a small sector of the research that's going on, and it's fairly new because of the new technologies in synthetic virology and genetic engineering. But it represents an existential threat.

Ralph Nader: What you're saying in legal terms is the burden of proof is on the scientists, not on the people who fear the consequences of it or on the potential victims. It's on the scientists and those in Congress and elsewhere who fund them.

 Let me quote your statement recently. This is Andrew Kimbrell:

"Unfortunately, many powerful forces at the NIH, World Health Organization, et cetera, have for self-interested reasons, including hundreds of millions in potential funding, continued to downplay the role of this profoundly hazardous research in the current pandemic, and its dangers in creating future pandemics."


You’re referring to the hazardous research where? And what are the self-interested reasons?

Andrew Kimbrell: Well, there are researchers who want to do this research, and they're doing it. I mentioned several by name. I don't know what it feels like to come home at dinner and say, "Hey, honey, I just created a novel pandemic bird flu that could kill 1.6 billion people if it got out of my laboratory." I can't think you could possibly explain that to yourself. It's done no good; hasn't helped anybody. The same is true with the research that Shi Zhengli was doing in the Wuhan Institute of Virology. It hasn't come with a vaccine. It hasn't helped us with any coronaviruses. All it did was create the potential and the possible -- some of us think probable -- pandemic that we're facing. And we know that this kind of research is going on around the world, and I think some of it's probably being secretly done for biological weapons research. So we need to expose this.

The genetic engineering movement has been very strong around the world. We've seen the dangers of genetic engineering bacteria and crops. We know the threats of trying to genetically engineer humans. We need to add to that, as part of our movement, to say that the genetic engineering of these pandemic viruses, to make them more threatening, by scientists who can do it but shouldn't do it, needs to be stopped, just like some of this other research. On an existential basis, it actually is even more threatening to the human population than other forms of genetic engineering.

Ralph Nader: Two questions. Why hasn't Congress had a congressional hearing on this in the House or Senate, since it's been going on a long time, and since Obama put a moratorium on it in 2014? You'd think the Democrats in the House would be interested in it, and the Science and Technology committee. And second, should there be an international treaty movement getting underway fast? Let's start with Congress.

Andrew Kimbrell: Yeah, I think there were, and again, I really want to give credit to the Cambridge Working Group. They haven't been speaking out lately, and I'm sorry they haven't, but the Cambridge Working Group did a great job. It's the group of scientists who got this moratorium done. Again, I'll mention Marc Lipsitch of Harvard, and Tom Inglesby at Johns Hopkins, who are both great scientists. We need them again. We need more hearings. We had them then, but that's six, seven years ago. We need them now urgently, because U.S. funding is a huge source in this. I will note that the No. 2 funder of the World Health Organization [WHO] after the United States is the Gates Foundation, not a country. The second greatest funding of the world happens to be with the Gates Foundation. We need people at the Gates Foundation, and we need these other countries to say, "You know what, we also are not going to support this particular jagged edge research, because it's very, very, very dangerous, and we shouldn't be doing it."

And yeah, if you look at the Global Health Security Index released in October, they have a series of suggestions, which are very important recommendations that include United Nations' overview of this, and international treaties. And it reminds me how at the beginning, when we started looking at nuclear fission, when we looked at that level of danger to the world, we didn't do so well back then. Maybe we can do better now, and get this research that is only about 10 or 11 years old stopped, and say, "No, we're not going to do this; this is way too dangerous. We as a human population, as an international community, as an international research community, are going to say no to that small little viral research industrial complex, which is really small but very powerful. Just say no!"

Ralph Nader: Andy, there seems to be a massive indifference here that requires a civic jolt. And you're a well-known activist. You've worked with legislatures. You've worked with initiatives on the ballot. You've litigated and won a lot of cases, especially in the Ninth Circuit against Monsanto and others. Tell us exactly what action your organizations are taking. And are you going to write a letter to Bill Gates? So exactly what actions, so people can attach themselves to it, and support them.

Andrew Kimbrell: Thank you, Ralph. Yes, I think we are going to specifically launch a major campaign among scientists. This is the National Center for Technology Assessment, and I'm sure we'll get many other groups with us that were supporting the first moratorium. The first thing we want to do is get the moratorium back. We want to say, "Lifting it during the Trump Administration was wrong; getting that moratorium done in the Obama administration was the right thing to do." We need to make it a little bit more extensive. We need to make sure it's more carefully monitored than it was, but still, it's not like we're starting from scratch. We did it right, and then it got lifted during the Trump administration. We want to reassert it. We may have bipartisan support from Democrats and Republicans. So we can go to Congress, and we think that's going to be more effective. There is possible litigation under the National Environmental Policy Act, and we're looking at that as well. And we want to look to some of our international partners that we've already reached out to to get some support, for example, from our friends at the European Union who are part of the GMO movement, which is a huge movement, as you know, around the world; and see if we can get them to understand how also banning genetic engineering of viruses fits in with the larger problems of dealing with the regulation and the moratoriums on genetic engineering.

The idea is to first start in this country. Because U.S. funding is so important to all of these things, let's get that moratorium back on track here. Let's work in Congress. Let's work in the regulatory area, but also let's do a little litigation as well. Then we need to look at the international community, and hopefully folks at the Global Health Security Index, and others who have recommended the United Nations take an active role in this for an international treaty. We also need to look back to the 1972 biological warfare convention, don't we, Ralph? We need to make sure that that's being enforced, because it won't help us that much to get rid of the medical part of this research if it's still ongoing in the biological warfare research.

Ralph Nader: Well, to frame all this, what about an open letter by your organization, signed by other coalition groups, to Donald Trump, and the leadership in the House and Senate from both parties? A comprehensive letter.

Andrew Kimbrell: Yeah, I think that's what we're going to need. And we're going to need some prominent scientists [to sign] onto that letter. And I think that we need to move the debate from tit-for-tat, China vs. anything else ,and trying to weaponize this discussion for political gains, whose purpose is for Trump or anyone else, and get to the real nub of it, which is that we can't stop natural pandemics from happening in nature -- that's going to happen -- but we can stop pandemics that originated in the laboratories around the world because people are deliberately creating them in those laboratories.

Ralph Nader: So on the open letter, to frame it for the media and for the citizenry, are you all for it? Can you do it?

Andrew Kimbrell: Yeah, absolutely.

Ralph Nader: Okay. Then we will look forward to it. We'll get people to sign it, and all these scientists you referenced shouldn't have any trouble signing it, because that's the only way you're going to get high-level visibility to something that is often not public, but proprietary, secret, you name it. When do you think you can get this done, Andy?

Andrew Kimbrell: I'm looking to this summer to really get this campaign on the road, and to get scientists lined up. I've already communicated with dozens of scientists. So we're going to put this together. There are some language issues. We want to make sure that the moratorium is correctly worded. We've got some good lawyers and good scientists working on that. So, yeah, we're going to be watching for it this summer, folks. So stay tuned.

Ralph Nader: And how can people get more information about your organization? What's your website?

Andrew Kimbrell: They can get more information through the http://www.icta, International Center for Technology Assessment, dot org. And there'll be more and more information on that website as this campaign really takes off this summer.

Ralph Nader: Okay. Steve, David, any concluding questions?

Steve Skrovan: Yeah. Andrew, how does a virus escape from a lab?

Andrew Kimbrell: There's numerous ways. It can escape because somebody didn't correctly wash their hands; didn't dispose of their clothing appropriately; it can escape through an animal that's been infected and not properly disposed of; it can escape through one lab sending the virus to another lab under the mistaken view that that virus has been killed or is disabled, and it hasn't been. This happens a lot actually. It's one of the major ways ... we did it with anthrax. CDC sent out a whole bunch of anthrax to about 100 labs around the world saying, "We killed this bacteria, don't worry about it," and it turns out it wasn't killed. So accidents can happen between lab transportation as well. But people can have a bad day; people don't pay attention; people are ill; or an animal is not properly disposed of; and viruses are sent in an unsafe manner to another laboratory. There are a number of vectors that can make that happen.

Steve Skrovan: So they're working on this theoretically as something with good intentions? They're working on this to try to get to the bottom of how you get a vaccine for a SARS coronavirus?

Andrew Kimbrell: No, this is not vaccine research. In vccine research, you try and kill, or make a vaccine less virulent in order to use it for vaccine. This is specifically to make that virus more virulent, to make that virus more transmissible and more infective. And the only reason they have for doing this outside of biological weapons research is because they say maybe this could happen out in nature, the combination they just did in the lab. And if it does, they could be ready for it. That's pretty much it. That's their rationale.

Steve Skrovan: Okay.

Ralph Nader: Well, very good. We're out of time, Andy. And I'm sure our listeners will send some questions in. This is a calm discussion; it's not going in one direction after another. And we clearly have to understand that even if we do everything right in the U.S., there are other countries that may have secret biological warfare research, or even worse lab security. So we've got to come together as a planet here with an international treaty. There are international treaties on weapons of mass destruction, as a precedent, to go to work on this. So we look forward to your open, comprehensive letter to Trump and the leadership on both sides in the House and Senate to get them involved, and get them on top of it. They did it once in 2014; they can do it again.

Andrew Kimbrell: And Ralph, I think that the point you make is so important, that if these technologies develop, and we're talking about synthetic biology, synthetic virology, the technology develops but our capacity as a world community, as an Earth community, to deal with it has not caught up with that technology. So it's a calm conversation, but for me inwardly I'm not so calm, more like Shi Zhengli, it's hard to sleep sometimes knowing that these technologies could go any further in creating these essential threats similar to nuclear and other genetic engineering. And as a global community, maybe COVID-19 is a wake-up call. I hope it is, and that we can say that we can no longer approach this just nationally. We cannot approach it as a political football, or weaponizing it on cable TV shows. That's nonsense. This is far too serious for that. It's far too important. We're looking towards the future, and future generations, and health, security and safety issues now and we need to deal with them comprehensively.

Ralph Nader: That's what I meant by calm. You can have a calm discussion and be very super urgent, which is what this whole interview is all about. Thank you very much. We've been talking with Andrew Kimbrell, who is, among other things, a founder of the Center for Food Safety, as well as director of the International Center for Technology Assessment. To be continued. We look forward to your comprehensive letter, and all kinds of groups, I'm sure, will want to join in. There's no time to lose here.

Andrew Kimbrell: No, no. I appreciate it, Ralph. As always, thanks for having me on. Stay healthy and safe, everybody, okay? To be continued.

Ralph Nader: Yeah. You're welcome.

Andrew Kimbrell: Thanks, guys. Thanks, Dave. Thanks, everybody.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 9:15 pm

Persistent Symptoms in Patients After Acute COVID-19
by Angelo Carfì, MD; Roberto Bernabei, MD; Francesco Landi, MD, PhD; et al
for the Gemelli Against COVID-19 Post-Acute Care Study Group
July 9, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


In Italy, a large proportion of patients with coronavirus disease 2019 (COVID-19) presented with symptoms (71.4% of 31 845 confirmed cases as of June 3, 2020).1 Common symptoms include cough, fever, dyspnea, musculoskeletal symptoms (myalgia, joint pain, fatigue), gastrointestinal symptoms, and anosmia/dysgeusia.2-4 However, information is lacking on symptoms that persist after recovery. We assessed persistent symptoms in patients who were discharged from the hospital after recovery from COVID-19.

Methods

In the waning phase of the pandemic, beginning on April 21, 2020, the Fondazione Policlinico Universitario Agostino Gemelli IRCCS in Rome, Italy, established a postacute outpatient service for individuals discharged from the hospital after recovery from COVID-19. All patients who met World Health Organization criteria for discontinuation of quarantine (no fever for 3 consecutive days, improvement in other symptoms, and 2 negative test results for severe acute respiratory syndrome coronavirus 2 [SARS-CoV-2] 24 hours apart) were followed up. At enrollment in the study, real-time reverse transcriptase–polymerase chain reaction for SARS-CoV-2 was performed and patients with a negative test result were included.

Patients were offered a comprehensive medical assessment with detailed history and physical examination. Data on all clinical characteristics, including clinical and pharmacological history, lifestyle factors, vaccination status, and body measurements, were collected in a structured electronic data collection system. The COVID-19 postacute outpatient service is currently active, and further details about the patient evaluation protocol are described elsewhere.5

In particular, data on specific symptoms potentially correlated with COVID-19 were obtained using a standardized questionnaire administered at enrollment. Patients were asked to retrospectively recount the presence or absence of symptoms during the acute phase of COVID-19 and whether each symptom persisted at the time of the visit. More than 1 symptom could be reported. The EuroQol visual analog scale was used to ask patients to score their quality of life from 0 (worst imaginable health) to 100 (best imaginable health) before COVID-19 and at the time of the visit. A difference of 10 points defined worsened quality of life. All analyses were performed using R version 3.6.3 (R Foundation).

This study was approved by the Università Cattolica and Fondazione Policlinico Gemelli IRCCS Institutional Ethics Committee. Written informed consent was obtained from all participants.

Results

From April 21 to May 29, 2020, 179 patients were potentially eligible for the follow-up post–acute care assessment; 14 individuals (8%) refused to participate and 22 had a positive test result. Thus, 143 patients were included. The mean age was 56.5 (SD, 14.6) years (range, 19-84 years), and 53 (37%) were women. During hospitalization, 72.7% of participants had evidence of interstitial pneumonia. The mean length of hospital stay was 13.5 (SD, 9.7) days; 21 patients (15%) received noninvasive ventilation and 7 patients (5%) received invasive ventilation. The characteristics of the study population are summarized in the Table.

Patients were assessed a mean of 60.3 (SD, 13.6) days after onset of the first COVID-19 symptom; at the time of the evaluation, only 18 (12.6%) were completely free of any COVID-19–related symptom, while 32% had 1 or 2 symptoms and 55% had 3 or more. None of the patients had fever or any signs or symptoms of acute illness. Worsened quality of life was observed among 44.1% of patients. The Figure shows that a high proportion of individuals still reported fatigue (53.1%), dyspnea [difficult or labored breathing] (43.4%), joint pain, (27.3%) and chest pain (21.7%).

Discussion

This study found that in patients who had recovered from COVID-19, 87.4% reported persistence of at least 1 symptom, particularly fatigue and dyspnea. Limitations of the study include the lack of information on symptom history before acute COVID-19 illness and the lack of details on symptom severity. Furthermore, this is a single-center study with a relatively small number of patients and without a control group of patients discharged for other reasons. Patients with community-acquired pneumonia can also have persistent symptoms, suggesting that these findings may not be exclusive to COVID-19.6

Clinicians and researchers have focused on the acute phase of COVID-19, but continued monitoring after discharge for long-lasting effects is needed.

Section Editor: Jody W. Zylke, MD, Deputy Editor.

Article Information

Corresponding Author: Angelo Carfì, MD, Centro Medicina dell’Invecchiamento, Fondazione Policlinico Universitario Agostino Gemelli IRCCS, Largo Francesco Vito 1, 00168 Rome, Italy ([email protected]).

Accepted for Publication: June 23, 2020.

Published Online: July 9, 2020. doi:10.1001/jama.2020.12603

Author Contributions: Drs Carfì and Landi had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis.

Concept and design: All authors.

Drafting of the manuscript: Carfì, Landi.

Critical revision of the manuscript for important intellectual content: Bernabei, Landi.

Statistical analysis: Carfì.

Supervision: Bernabei, Landi.

Conflict of Interest Disclosures: None reported.

Additional Information: The members of the Gemelli Against COVID-19 Post-Acute Care Study Group are listed in reference 5.

References

1. Istituto Superiore Sanità. Sorveglianza Integrata COVID-19 in Italia. Published 2020. Accessed June 8, 2020. https://www.epicentro.iss.it/coronaviru ... %20ITA.pdf
2. Docherty AB, Harrison EM, Green CA, et al; ISARIC4C Investigators. Features of 20 133 UK patients in hospital with COVID-19 using the ISARIC WHO Clinical Characterisation Protocol: prospective observational cohort study.  BMJ. 2020;369:m1985. doi:10.1136/bmj.m1985PubMedGoogle ScholarCrossref
3. Wang D, Hu B, Hu C, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China.  JAMA. 2020;323(13):1239-1242. doi:10.1001/jama.2020.1585
ArticlePubMedGoogle ScholarCrossref
4. Landi F, Barillaro C, Bellieni A, et al. The new challenge of geriatrics: saving frail older people from the SARS-CoV-2 pandemic infection.  J Nutr Health Aging. 2020;24(5):466-470. doi:10.1007/s12603-020-1356-xPubMedGoogle ScholarCrossref
5. Gemelli Against COVID-19 Post-Acute Care Study Group. Post-COVID-19 global health strategies: the need for an interdisciplinary approach.  Aging Clin Exp Res. Published online June 11, 2020. doi:10.1007/s40520-020-01616-xPubMedGoogle Scholar
6. Metlay JP, Fine MJ, Schulz R, et al. Measuring symptomatic and functional recovery in patients with community-acquired pneumonia.  J Gen Intern Med. 1997;12(7):423-430. doi:10.1046/j.1525-1497.1997.00074.xPubMedGoogle ScholarCrossref

********************************

COVID: Clinical Considerations for Acute and Post-Infection Symptoms: From chest pain and severe headache to neurological symptoms and multisystem disease, manifestations of the SARS-CoV-2 virus present clinicians with new and complicated assessment challenges. Sample case scenarios, exacerbated pain, and long-term convalescence are addressed. [EXCERPT]
by Don L. Goldenberg, MD
practicalpainmanagement.com
Accessed: 7/28/20

[...]

Strokes in younger people have been especially alarming, including a recent report describing five cases in New York of large-vessel strokes in patients aged 33, 37 39, 44, and 49.11 This rate of strokes in patients under age 50 is more than 8-fold greater than expected based on prior years. Each patient was at home and each experienced the sudden onset of slurred speech, confusion, facial drooping, and dead feeling in one arm...

A 65-year-old male nursing-home resident presents with a 1-day history of numbness and tingling in both legs, as well as ataxia, and exhaustion. Over the past 24 hours, he has developed bilateral leg and facial muscle weakness. He has no history suggesting recent infection, but two residents and one caretaker of the nursing home were just diagnosed with COVID-19 infection. This patient may have Guillain Barre Syndrome (GBS) [GBS is characterized by the rapid onset of numbness, weakness, and often paralysis of the legs, arms, breathing muscles, and face. Paralysis is ascending, meaning that it travels up the limbs from fingers and toes towards the torso. Loss of reflexes, such as the knee jerk, are usually found.], possibly triggered by COVID-19.

A number of similar cases of COVID-19 related GBS have been reported from China, Iran, and Italy.15 One case described a 61-year-old man who had recovered from a confirmed COVID-19 infection and, after 10 days, developed a right facial nerve palsy.
His physicians considered this facial diplegia to be an atypical variant of GBS as a late manifestation of his COVID-19 infection.

There have also been scattered case reports of persistent axonal neuropathy [Acute motor axonal neuropathy (AMAN) is a variant of Guillain–Barré syndrome. It is characterized by acute paralysis and loss of reflexes without sensory loss.] and vasculitis [Vasculitis is an inflammation of the blood vessels. It happens when the body's immune system attacks the blood vessel by mistake. It can happen because of an infection, a medicine, or another disease. The cause is often unknown. Vasculitis can affect arteries, veins and capillaries.] following COVID-19.

COVID-19 has been associated with unusual neurologic symptoms, such as GBS.
Neurologic symptoms warrant timely referral to a neurologist and diagnostic testing, including electromyogram (EMG), a nerve conduction velocity test, and confirmatory tests for acute infection or antibodies obtained...

Unusual painful skin lesions have also been considered to be part of the infection or a post-infectious immune process. Such lesions often have developed weeks after the acute COVID-19 infection and have included purpura, chilblains-like lesions and more generalized rashes, often seen in patients with systemic vasculitis. Painful skin lesions in the feet have been dubbed as COVID-toe.

Akin to what dermatologists describe as chilblains, Lindy Fox, MD, a dermatologist in San Francisco, shared, “All of a sudden, we are inundated with toes, I’ve got clinics filled with people coming in with new toe lesions. And it’s not people who had chilblains before — they’ve never had anything like this.”
These skin lesions do occur in adults as well, including a recent report from Spain of a 91-year-old and a 44-year-old, both male.

A 62-year-old female, previously very healthy, was discharged from the hospital 6 weeks ago after recovering from acute COVID-19 infection. She was hospitalized for two weeks with lung involvement and breathing difficulties although she did not require intubation or mechanical ventilation. Her treatment included nasal oxygen and anti-viral drug therapy. Once her breathing improved and her chest CT scan demonstrated resolution of the lung infiltrates, she was discharged. Since being home, she has had persistent generalized pain but no joint swelling or inflammation. She continues to be exhausted and reports difficulty sleeping or concentrating.

This patient is likely experiencing a prolonged, post-COVID-19 convalescence. Her symptoms are similar to those reported to the New York Times by patients from Italy, “But even some of the infected who have avoided pneumonia describe a maddeningly persistent and unpredictable illness, with unexpected symptoms. Bones feel broken. The senses dull. Lack of energy. Stomachs are constantly upset. There are good days and then bad days without apparent rhyme nor reason. The afflicted find the simplest tasks taxing.”

Alessandro Venturi, MD, director of the San Matteo Hospital in the Lombardy town of Pavia, Italy, noted, “It’s not the sickness that lasts for 60 days, it is the convalescence. It’s a very long convalescence. We have seen many cases in which people take a long, long time to recover.”

Clinicians should expect recovering COVID patients to have a prolonged convalescence, with potential new – or worsened – bouts of chronic pain (more on this below), exhaustion, and cognitive disturbances.

Increased stress, anxiety, lack of exercise, and worry about access to healthcare professionals all may precipitate migraine.
Thus, patients with chronic migraine are likely to have increased attacks related to the COVID-19 pandemic...

Patients who have been hospitalized with COVID-19, as well those of us indirectly affected, may develop a post-traumatic stress disorder (PTSD). Drs. Dhruv Khullar and Daniela Lamas , both critical care physicians in New York and Boston, described their concern with post-COVID recovery.27, 28

Lamas wrote: “At least we know how to track and treat the physical consequences of our patients’ prolonged ICU stays. These outcomes are visible. More insidious are the potential psychiatric and cognitive dysfunction that some former ICU patients describe — anxiety and depression; hyperarousal and flashbacks to delirium-induced hallucinations that are characteristic of post-traumatic stress; poor planning skills and forgetfulness that might make it hard to remember medications or appointments. These are far trickier to screen for and to treat.”...

Khullar shared: “The joy we all feel when patients at our hospital survive acute COVID-19 is followed, quickly, by the acknowledgment that it could be a long time before they fully recover, if they ever do. Many will suffer through months of rehabilitation in unfamiliar facilities, cared for by masked strangers, unable to receive friends or loved ones. Families who just weeks ago had been happy, healthy, and intact now face the prospect of prolonged separation. Many spouses and children will become caregivers, which comes with its own emotional and physical challenges. Roughly two-thirds of family caregivers show depressive symptoms after a loved one’s stay in the ICU. Many continue to struggle years later.”

The prevalence of such PTSD symptoms in the general population since the pandemic began is not yet known. Early population estimates from China and Italy found a two to three-fold increase in depression and anxiety since SARS-CoV-2 began to spread...

It is very likely that we will also see a surge in chronic pain conditions in the general population. Most chronic pain conditions are aggravated by stress and intimately tied to increasing mood and sleep disturbances.

Conclusion

Chest pain, severe headaches, or any new neurologic symptoms may represent manifestations of acute COVID-19 infection. Such symptoms may also develop later in the viral infection, even when the patient seems to be on the road to recovery. Unique, post-infectious, multisystemic complaints, although still rare, have drawn increased attention. These symptoms include conditions similar to Kawaski disease [Kawasaki disease is an illness that causes inflammation (swelling and redness) in blood vessels throughout the body], Guillain-Barre Syndrome [GBS is characterized by the rapid onset of numbness, weakness, and often paralysis of the legs, arms, breathing muscles, and face. Paralysis is ascending, meaning that it travels up the limbs from fingers and toes towards the torso. Loss of reflexes, such as the knee jerk, are usually found.], and vasculitis [Vasculitis is an inflammation of the blood vessels. It happens when the body's immune system attacks the blood vessel by mistake. It can happen because of an infection, a medicine, or another disease. The cause is often unknown. Vasculitis can affect arteries, veins and capillaries.], and are likely secondary to an immune response following the infection.

Patients often have a prolonged post-COVID-19 convalescence, with persistent chronic pain, exhaustion and cognitive disturbances. It is likely that chronic pain conditions in the general population, including migraine and fibromyalgia, will be more problematic in the coming months following the increased stress we all feel as a result of the pandemic.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 10:56 pm

Months after infection, many COVID-19 patients can't shake illness
by American Heart Association News
July 6, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


It was a Tuesday in late March when Julia Henry first felt the body aches and dry cough that signaled the start of her bout with COVID-19. By that weekend, her husband and three children also were sick. But the kids were fine less than a week later, her husband within two weeks.

"My husband just woke up one day starting to feel back to normal, and I kept waiting for that day when I would have that feeling. But I never did. I never did," said Henry, a 40-year-old physical therapist from New Hampshire.

"For more than two months, I couldn't do much of anything," she said. "Now after three months, I'm finally starting to be able to do some normal, everyday things, like play with my kids or cook dinner for my family."

As of early July 6, there have been nearly 2.9 million confirmed cases of COVID-19 in the United States, according to Johns Hopkins University's oft-used tracker. Of those, 906,763 – about 31% – are listed as "recovered." But recovery isn't the same for everyone. The World Health Organization reports the median time for recovery is up to two weeks for those with mild cases, while those with more severe cases can take up to six weeks for symptoms to resolve.

Some people, however, say they continue to experience symptoms months after infection. In doctor visits and on social media groups, a growing number of patients report lingering symptoms ranging from mild issues, such as continued loss of taste or smell, to more serious ones, such as heart palpitations, chest pain, shortness of breath, extreme fatigue, cognitive difficulties or recurring fevers.
Whether these symptoms eventually resolve or whether they signal permanent damage from the virus remains unknown.

"It has been just six months since the virus was detected in China, so nobody can tell you for sure if these are short-term or long-term complications," said Dr. Samer Kottiech, a cardiologist in New York City who estimates 90% of his patients who come in after COVID-19 infections experience prolonged symptoms.

Kottiech, who was himself infected in March, said he hasn't fully recovered either.

"The biggest problem is that my lung capacity is still a little bit decreased," he said. "I used to be very active. Now I don't feel like I can exercise like I used to."


With little data to go on, it is too soon to draw conclusions about what's happening to those with lingering issues, said Dr. Avindra Nath, head of clinical neurology at the National Institutes of Health's Institute for Neurological Disorders and Stroke.

He believes several things could be occurring: the patient could have an underlying condition, such as heart disease or diabetes, which they didn't know was there prior to infection; the virus, or the body's immune system response to it, could be causing new damage; or, the patient may be experiencing something called post-viral fatigue syndrome, a condition reported in some patients infected with other coronaviruses, such as SARS and MERS.

"What we know from these other viral infections is that they can cause problems that last for years," Nath said.


Nath is preparing to enroll patients in a study that will investigate what's going on in the immune systems of people who don't fully recover from COVID-19.

"There is some abnormality in the immune system that's doing it," he said. "We want to find out what those abnormalities are. Once you figure that out, you can potentially treat them."

Unlike trying to unravel what's happened to the immune systems of patients who have felt ill for years, Nath said, "we now have an excellent opportunity, because we know what these patients had and exactly when they had it. It is early enough in the course of this illness that we can learn a lot about how and why these symptoms are occurring, which could have broad implications for all people with post-viral syndrome."

However, people with lingering COVID-19 symptoms shouldn't assume they'll stay ill for years, Nath said. "I want to reassure people there is still time for them to get better. Even if they are only gradually improving, if they are getting better at all, they will probably continue to do so."

Editor's note: Because of the rapidly evolving events surrounding the coronavirus, the facts and advice presented in this story may have changed since publication. Visit Heart.org for the latest coverage, and check with the Centers for Disease Control and Prevention and local health officials for the most recent guidance.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 11:02 pm

Coronavirus symptoms: Mysterious, scary symptoms persist long after initial COVID-19 infection
by Chuck Goudie and Barb Markoff, Christine Tressel and Ross Weidner
ABC News
Monday, July 27, 2020 8:38PM

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.

Summary of Survey Findings:

• Long Haulers’ COVID-19 symptoms are far more numerous than what is currently listed on the CDC’s website
• While the impact of COVID-19 on the lungs and vascular system have received some media and medical attention, the results of this survey suggest that brain, whole body, eye, and skin symptoms are also frequent-occurring health problems for people recovering from COVID-19
• Survivor Corp group members frequently report reaching out to primary care doctors for help managing such lesser-known and painful symptoms, but find that some physicians are unable or unwilling to help patients manage these due to lack of research
• A reported 26.5% of symptoms experienced by Long Haulers are described as painful by the group members...

The 50 Most Common Long Hauler Symptoms: Fatigue; Muscle or body aches; shortness of breath or difficulty breathing; difficulty concentrating or focusing; inability to exercise or be active; headache; difficulty sleeping; anxiety; memory problems; dizziness; persistent chest pain or pressure; cough; joint pain; heart palpitations; diarrhea; sore throat; night sweats; partial or complete loss of sense of smell; tacycardia; fever or chills; hair loss; blurry vision; gonested or runny nose; sadness; neuropathy in feet and hands; reflux or heartburn; changing symptoms; partial or complete loss of sense of taste; phlegm in back of throat; abdominal pain; lower back pain; shortness of breath or exhaustion from bending over; nausea or vomiting; weight gain; clogged ears; dry eyes; calf cramps; tremors or shakiness; sleeping more than normal; upper back pain; floaters or flashes of light in vision; rash; constant thirst; nerve sensations; tinnitus or humming in ears; changed sense of taste; sharp or sudden chest pain; confusion; muscle twitching; feeling irritable.

-- COVID-19 “Long Hauler” Symptoms Survey Report: A Study Conducted by Dr. Natalie Lambert and Survivor Corps, 7/25/2020

Thousands of patients are suffering from a range of scary and bewildering symptoms long after their initial bout with COVId19 is over.

CHICAGO (WLS) -- Across the globe people are reporting persistent, mysterious and frightening symptoms for weeks and months after becoming infected with COVID-19.

Patients with severe disease would be expected to suffer from long-lasting consequences. But the ABC7 I-Team found a growing number of younger people, even those with a milder form of the virus, are experiencing bizarre and frightening long-term symptoms. They have become known as the "long haulers."

Medical experts and researchers are now scrambling to find the triggers and best treatments for those who can't seem to get better from this post-viral syndrome.

The unusual symptoms include brain fog, loss of sense or smell, headaches, fevers and chronic fatigue. Some of the more severe ailments being reported are spiking blood pressure, racing heart beats and blood clots.


Elizabeth Moore from Northwest Indiana is one of those patients. Months after getting over COVID-19 she started having frightening, unexplained symptoms.

"I could feel it in my body out of nowhere, this sort of buzzing, rushing sensation, tingling in my arms, especially in my left but it was on both sides," she said.

The 43-year-old wife, mother and lawyer said she never had medical issues until now.

She said she would try to sleep, but the tingling sensation would jolt her awake and leave her gasping for air. Moore said it would feel as if someone was pouring ice cold water down her back. Her heart would race and her blood pressure would spike to dangerous levels.

"I truly thought I had a heart attack or a stroke, like that's what it felt like to me. It was terrifying," she said.

Moore said she's also suffering from symptoms ranging from extreme fatigue, brain fog and, most recently, intense gastrointestinal issues.

She's been to the emergency room twice with no resolutions. One doctor told her she might just be suffering from gastroesophageal reflux disease or GERD.


Moore and other frustrated patients are joining online forums and social media sites to find support, validation and answers.

Diana Berrent is the founder of one such site, called Survivor Corps.

"Over and over and over again, people are being turned away by their doctors, being given diagnoses of anxiety. And when their lab reports are saying nothing of the kind," she said.

Survivor Corps is a grassroots organization with an estimated 80,000 members on Facebook.

Berrent, a New York photographer, started the non-profit after posting about her own COVID-19 journey. She discovered there were many people who were feeling anxious and alone as they were dealing with the virus.

She said the group's core mission is to connect the survivor community with the opportunity to donate plasma and support scientific research related to COVID-19.

"We have sort of unintentionally created the world's greatest data set on survivors, that is being recorded in real time," she said.

Results of a survey conducted by the group and analyzed by researcher Natalie Lambert at the Indiana University Medical School was just released. It finds "long hauler" symptoms are far more numerous than what is currently listed on the CDC's website. The Survivor Corps list is extensive.

"Doing these sorts of analysis projects, this is just the first of many that we will be putting out and disseminating. We are an open source from beginning to end, so we will be disseminating this to the entire medical community. We want doctors to be aware of this, we want patients to be aware of this, it will be available for everybody to download on our website," said Berrent.

With so many unknowns about a virus only discovered about seven months ago, some researchers said they are open to crowdsourced information and collaboration.

The CDC just acknowledged in a new report that one-third of COVID-19 patients who were not hospitalized may experience long term symptoms weeks after their initial illness.

Earlier in July a study in JAMA Network analyzed a little over 140 patients in Italy. It found nearly 90% of patients who recovered from COVID-19 reported some kind of lingering symptom, including breathing issues and fatigue.

"The virus should not be taken lightly, it's causing a lot of damage in multiple different organ systems. And so, it's not surprising that people have symptoms that persist for extended periods," said Dr. Avindra Nath, Clinical Director of the National Institutes of Neurological Disorders and Stroke.


He said it is too early to reach any conclusions, including whether the lingering issues will be permanent.

Nath is launching several studies at the National Institutes of Health to look at the immune systems of patients and study the neurological complications of the virus.

"We're going to try to figure out how much of that may be coming from a deranged immune system and how much of that may be coming through persistent viral infection," he said.

In Chicago, the Neuro COVID-19 Clinic at Northwestern Memorial Hospital is one of only a handful of medical centers dedicated to studying and treating these long term effects.

Dr. Igor Koralnik, chief of Infectious Diseases and Global Neurology at Northwestern Medicine, said the virus can start an inflammatory response in the body that can lead to a multitude of different symptoms.

He said other causes can be a direct invasion of the nervous system by the virus or a post-infectious autoimmune manifestation.


Koralnik said the clinic is providing care for patients who experience side effects and is also studying the long-term effects COVID-19 can have on the brain, nervous system and muscles.

"And so we are learning by following them over time, to see how long those complications are, and how to manage them In the meantime," he explained.

And, he added, "The COVID-19 Clinic is open to everyone from all over the US, and we can accommodate people in televisits or in-person visits as they prefer."

Moore discovered the clinic in a support group posting and just became a patient.

"Finding Northwestern was a relief, just to have, at least, someone besides being on a social media group, have a doctor say you're not crazy," she said.

She wants other patients who might be feeling hopeless to know that they are not alone.

"Now that we're starting to get, you know, doctors on board, who are willing to research and look into what's going on I think that's a really positive thing and you just need to keep moving in that direction," said Moore.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 4:24 am

Part 1 of 2

Did the SARS-CoV-2 virus arise from a bat coronavirus research program in a Chinese laboratory? Very possibly.
by Milton Leitenberg
Bulletin of the Atomic Scientists
June 4, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


Image
This scanning electron microscope image shows SARS-CoV-2 in yellow. This scanning electron microscope image shows SARS-CoV-2 in yellow. (Photo credit: Credit: NIAID-RML)

On May 15, the Bulletin of the Atomic Scientists published a short commentary titled, “Let evidence, not talk radio, determine whether the outbreak started in a lab,” by Ali Nouri, a biologist and president of the Federation of American Scientists. “The outbreak” referred to the pandemic of SARS-CoV-2 now circling the globe. It is a thin commentary, and it is puzzling why the Bulletin thought it desirable to publish it at all. Only two weeks earlier the journal had published a reasoned and competent appraisal by Kings College London biosecurity expert Filippa Lentzos titled, “Natural spillover or research lab leak? Why a credible investigation is needed to determine the origin of the coronavirus pandemic.”

The Nouri article very correctly pilloried the statements by President Donald Trump, Secretary of State Mike Pompeo, presidential legal advisor Rudy Giuliani, and radio personality Rush Limbaugh. These are as notorious a gang of four fabricators as will ever likely be recorded in American history. They were ably assisted by Fox News, which the Nouri critique also mentions. Nouri ended his commentary with these lines: “Our leaders ought to … take steps to prevent the next pandemic, instead of diverting our attention to unsupported sensationalist theories spread by cable TV and talk radio.”

Perhaps the most damaging blows to efforts to obtain a certain answer as to the origin of the SARS-CoV-2 “outbreak” have been the pronouncements by Trump, Pompeo, and their echo chambers. But they and their remarks are not the measure by which the question of the possibility that a laboratory escape began the pandemic should be examined. Trump’s diversionary ranting comes from a president who did nothing for two months in the face of an oncoming lethal pandemic, actively denied and denigrated intelligence warnings of the imminent danger, and said that SARS-CoV-2 would “just go away … like a miracle” and that “within a couple of days is going to be down close to zero.” All this has been widely and thoroughly chronicled.1

But long before Trump, Pompeo and Co. sought a Chinese scapegoat for the president’s gross and willful incompetence, researchers understood that the possibility of laboratory escape of the pathogen was a plausible, if unproven, possibility. It is most definitely not “a conspiracy theory.”


The circumstantial evidence for a lab escape.

By way of introduction, there are two virology institutes in Wuhan to consider, not one: The Wuhan Center for Disease Control and Prevention (WHCDC) and the Wuhan Institute of Virology (WIV). Both have conducted large projects on novel bat viruses and maintained large research collections of novel bat viruses, and at least the WIV possessed the virus that is the most closely related known virus in the world to the outbreak virus, bat virus RaTG13. This virus was isolated in 2013 and had its genome published on January 23, 2020. Seven more years of bat coronavirus collection followed the 2013 RaTG13 isolation.

One component of the novel-bat-virus project at the Wuhan Institute of Virology involved infection of laboratory animals with bat viruses. Therefore, the possibility of a lab accident includes scenarios with direct transmission of a bat virus to a lab worker, scenarios with transmission of a bat virus to a laboratory animal and then to a lab worker, and scenarios involving improper disposal of laboratory animals or laboratory waste.


Image
A May 20, 2020, photo of the Wuhan Institute of Virology in Wuhan, where research on bat coronaviruses was conducted. (Photo by Kyodo News via Getty Images)

Documentary evidence indicates that the novel-bat-virus projects at Wuhan CDC and the Wuhan Institute of Virology used personal protective equipment and biosafety standards that would pose high risk of accidental infection of a lab worker upon contact with a virus having the transmission properties of the outbreak virus.

In assessing the possibility of a lab accident, one must take into consideration each of the following eight elements of circumstantial evidence:

1. Official Chinese government recognition early in the SARS-CoV-2 outbreak of biosafety inadequacies in China’s high containment facilities.


In February 2020, several weeks after the outbreak of the disease in Wuhan, China’s President Xi Jinping stressed the need to ensure “biosafety and biosecurity of the country.”2 This was followed immediately by a China Ministry of Science & Technology announcement of new guidelines for laboratories, especially in handling viruses.3 Almost at the same time, the Chinese newspaper Global Times published an article on “chronic inadequate management issues at laboratories, including problems of biological wastes.”4

A PBS NewHour presentation on May 22, 2020 provided the following information:

On January 1, Wuhan Institute of Virology’s director general, Yanyi Wang, messaged her colleagues, saying the National Health Commission told her the lab’s COVID-19 data shall not be published on social media and shall not be disclosed to the media. And on January 3, the commission sent this document, never posted online, but saved by researchers, telling labs to destroy COVID-19 samples or send them to the depository institutions designated by the state. Late Friday [May 16, 2020] the Chinese government admitted to the destruction … but said it was for public safety.


The Chinese government explanation for the destruction of SARS-CoV-2 samples has no scientific credibility. For purposes of “public safety” any samples would surely be stored and studied, exactly as with the ones that were isolated from patients, and their RNA genomes decoded and published.

2. Recognition by Zhengli Shi, a renowned scientist who leads a research team at the Wuhan Institute of Virology, that a laboratory escape was a possibility.

Shi took the possibility of a laboratory escape perfectly seriously. Jonna Mazat of the University of California-Davis, a collaborator with Dr Shi, told Josh Rogin of the Washington Post, “Absolutely, accidents can happen.” In an interview with Scientific American, Shi admitted that her very first thought was “If coronaviruses were the culprit, she remembers thinking ‘Could they have come from our lab?’”

Meanwhile she frantically went through her own lab’s records from the past few years to check for any mishandling of experimental materials, especially during disposal. She breathed a sigh of relief when the results came back: none of the sequences matched those of the viruses her team had sampled from bat caves. ‘That really took a load off my mind,’ she says. ‘I had not slept a wink for days.’


3. Questions surrounding Chinese government attribution of the Wuhan’s Huanan South China Seafood Market as the source of the SARS-CoV-2 virus.

Many China scholars noted that it was quite unusual for Chinese government authorities to identify Wuhan’s Huanan South China Seafood Market so quickly as the source of the outbreak. They thought this behavior so uncharacteristic that it raised suspicions in their minds. The authors of a newly published paper wrote that

…we were surprised to find that SARS-CoV-2 resembles SARS-CoV in the late phase of the 2003 epidemic after SARS-CoV had developed several advantageous adaptations for human transmission. Our observations suggest that by the time SARS-CoV-2 was first detected in late 2019, it was already pre-adapted to human transmission to an extent similar to late epidemic SARS-CoV. However, no precursors or branches of evolution stemming from a less human-adapted SARS-CoV-2-like virus have been detected…. It would be curious if no precursor or branches of SARS-CoV-2 evolution are discovered in humans or animals….Even the possibility that a non-genetically-engineered precursor could have adapted to humans while being studied in a laboratory should be considered, regardless of how likely or unlikely.5


It is important to note that no intermediary host has yet been identified for the SARS-CoV-2 virus. The authors also noted that “[n]o animal sampling prior to the shutdown and sanitization [of the Wuhan fish market] was done.”

Image

The question of whether the index case appeared in the Wuhan fish market appears to be moot in any case. Chinese researchers have published data showing that there were 41 cases of SARS-CoV-2 between December 1, 2019 and January 2, 2020. Fourteen of these had no contact with the Huanan seafood market, including the very first recorded case on December 1, 2019.6 And that supposes that the true index case was December 1, which is doubtful.

On May 26, the Chinese government scrapped the previous official story about the Wuhan fish market:


China’s top epidemiologist said Tuesday that testing of samples from a Wuhan food market, initially suspected as a path for the virus’s spread to humans, failed to show links between animals being sold there and the pathogen. Gao Fu, director of the Chinese Center for Disease Control and Prevention, said in comments carried in China state media.7


No SARS-CoV-2 isolates were detected in any of the animals or fish sold at the market, only in environmental samples, including sewage. Gao Fu added, “At first, we assumed the seafood market might have the virus, but now the market is more like a victim. The novel coronavirus had existed long before.”8

4. Suppression of information and individuals by Chinese authorities.

A publication by two Chinese university academics discussed both the WHCDC and the WIV and concluded that “the killer coronavirus probably originated from a laboratory in Wuhan”; the publication was removed from the internet by Chinese government officials. The paper had been posted on Research Gate but was blocked after 24 hours. After being placed on an archive file by internet users, it was again blocked after a week, and the two Chinese authors were pressured to retract the paper. However, it is still available on Web archives.9

The Chinese government closed the laboratory in Shanghai that first published the genome of COVID-19 on January 10, explaining that it had been shuttered for “rectification”; the closure happened on January 11. The government then permitted the same genome to be published by Shi on January 12.10 Chinese citizens who reported on the coronavirus were censured and, in some cases, “disappeared.”11 These have included businessman Fang Bin, ...

Fang Bin (Chinese: 方斌) is a Chinese businessman, citizen journalist and whistleblower who used Youtube and WeChat to broadcast images of Wuhan during the COVID-19 pandemic. He was arrested several times between February 1 and 9, 2020. He has been missing since his arrest on February 9, 2020...

On February 1, 2020, Fang released a new video showing the piling up of corpses at the back of a minivan in front of a Wuhan hospital. The video was shared on Twitter by Chinese journalist Jennifer Zeng. Fang was arrested on the same day, warned and eventually released during the night.

In February 2020, Fang and two other citizen journalists and whistleblowers, Chen Qiushi and Li Zehua, were arrested and went missing in Wuhan. Chen, a lawyer who arrived in Wuhan on January 23, disappeared first on February 6; one week prior, he had uploaded a video criticising the Chinese government's manipulation of information which ended with the sentence "I am not afraid to die! You think I am afraid of you communist party?". Li, another citizen journalist, went missing in late February, but reappeared in April posting a neutral, patriotic video, in contrast to his previous tone.

Two days before Chen's arrest, on February 4, the police came twice to Fang's apartment. He recorded the scene and refused to let them in without a warrant, worried that they had come in large numbers to arrest him (he counted at least four officers). Fang kept making videos from his apartment during the following days, criticising the government's propaganda and its choice to arrest Chen and Li Wenliang. On February 9, he released his last video: a 12-second clip showing a piece of paper with the sentence "resist all citizens, hand the power of the government back to the people" written on it. He has been missing ever since.

-- Fang Bin, by Wikipedia


lawyer Chen Qiushi,...

Chen Qiushi; born September 1985) is a Chinese lawyer, activist, and citizen journalist who covered the 2019–20 Hong Kong protests and the COVID-19 pandemic which included criticism of the government response. He was last heard from on 6 February 2020; as of July 2020, his whereabouts remain unknown. The Chinese government reportedly informed Chen's family and friends that he has been detained for the purpose of COVID-19 quarantine. Critics, including media freedom groups, have expressed skepticism about government motives, and have unsuccessfully called on the government to allow outside contact with Chen...

Chen began reporting on the COVID-19 pandemic in China, travelling to Hankou, Wuhan, on 23 or 24 January 2020, where he interviewed the locals and visited various hospitals including Huoshenshan Hospital, which was still under construction at the time. According to Chen, doctors were overworked and there were insufficient medical supplies, but prices of goods were otherwise stable. Chen published a video on 30 January showing the crowding in Wuhan hospitals, with many people lying in corridors. Unlike state media reporters who had hazmat suits, Chen appeared to have only goggles and a face mask to protect himself. Chen stated, "I am afraid. In front of me is disease. Behind me is China's legal and administrative power. But as long as I am alive I will speak about what I have seen and what I have heard. I am not afraid of dying. Why should I be afraid of you, Communist Party?— Chen Qiushi, 30 January 2020."

By early February 2020, while reporting about the coronavirus outbreak, Chen had 433,000 YouTube subscribers and 246,000 Twitter followers. Chen's supporters accused the Chinese government of censorship of the coronavirus outbreak. According to The Guardian, many pro-Chen comments on Sina Weibo were censored. Around 4 February, in the last video posted by Chen before his subsequent disappearance, Chen interviewed Wuhan resident "A Ming". A Ming stated his father had probably contracted coronavirus during a health check-up in the beginning of January, when there were no safety precautions; A Ming's father had subsequently died from the virus. During the video Chen stated "many people are worried I will be detained"...

Chen disappeared on 6 February 2020, at some point after informing his family of an intention to report on a temporary hospital. His friends were unable to contact him after 7 pm UTC+8 on 6 February. His mother, and friend Xu Xiaodong, have both stated that on 7 February, they received news from authorities that Chen had been detained at an undeclared time and place and held in an unknown location for the purpose of quarantine...

Around March 2020 it was reported that Li Zehua, a citizen journalist in part inspired by Chen, had also disappeared...

On 23 March, the Chinese Ambassador to the US, Cui Tiankai, stated he'd never heard of Chen... Li Zehua resurfaced in April 2020, stating he had been released on 28 March from a quarantine.-- Chen Qiushi, by Wikipedia


former state TV reporter Li Zehua ...

Li Zehua... is a Chinese citizen journalist, rapper and YouTuber... After graduating from Communication University of China, he joined China Central Television (CCTV) as a television presenter in 2016.

During the COVID-19 pandemic in China, he resigned from CCTV and found a way to get into Wuhan, hoping to trace disappeared journalist Chen Qiushi. With the help of locals, he was able to get a car and find a place to stay. In the following days, he used a vlog to report on the pandemic in Wuhan. He disappeared on 26 February 2020, presumed detained by officers from state security. Parts of his chase with the Wuhan authorities was caught on video and uploaded to YouTube. It was reported that Li Zehua returned to the hotel on 28 February. However, other reports stated that no one has heard from Li since his 26 February 2020 disappearance.

On 22 April 2020, Li posted a video on Youtube, Twitter, and Weibo, and uploaded the English subtitle to YouTube in the following days. According to Li, he was escorted on 26 February to the police station and was under investigation for disrupting public order. Additionally, police detained and quarantined him, citing his visits to sensitive epidemic areas. Li's quarantine was at first in Wuhan, and later moved to his hometown. Li stated that he had been treated well by the police during the detention, and that he had been released on 28 March...

At the end of his April 22 post, he quoted the Book of Documents aphorism "the mind of man is restless, prone (to err); its affinity to what is right is small. Be discriminating, be uniform (in the pursuit of what is right), that you may sincerely hold fast the Mean."... and gave his own interpretation in English:

The will of the people is unpredictable, the heart of Tao (the essence of cosmos) is fathomless. In order to make the will of the people consistent with the heart of Tao and reach the state of Unity of people and cosmos [zh], only the way is concentrate all energy on cultivation of the good nature of the heart, do not act in extreme, do not change faith, do not be fickle, uphold the doctrine of the golden mean of Confucian orthodoxy.

-- Li Zehua, by Wikipedia


and, most recently, Zhang Zhan, a lawyer.

A "citizen journalist" who has reported on the coronavirus emergency in Wuhan (Hubei), the epicenter of the pandemic, has been detained in a prison in Shanghai, the city where she resides, since February.

Zhang Zhan had disappeared on May 13, after live YouTube streaming from Hankou train station square. According to some of her friends, she was arrested on May 15 for "disturbing social stability and creating problems of public order".

In her stories, posted on YouTube, Twitter and other social media, the 37-year-old often attacked the Chinese government, whom she reputed at fault in having inadequately managed the crisis and depriving the Chinese people of their fundamental rights. In a February 16 Twitter post, Zhang accuses the authorities of lying about the actual number of Covid-19 victims to maintain stability.

During her stay in Wuhan, she also provided legal assistance to Yang Min, a woman who had asked for justice for her daughter who died of coronavirus, and therefore was placed under house arrest. Zhang had been arrested as early as September in Shanghai: she spent 60 days in prison for demonstrating in favor of Hong Kong's pro-democracy demonstrators.

Three other "citizen journalists" disappeared in Wuhan in February. Li Zehua, who had talked about the crematoriums of the city open 19 hours a day, reappeared on April 22 after a period under arrest. However, there is no news of Fang Bin and Chen Qiushi...

Since mid-March there has been no news of Ai Fen, the Wuhan doctor who raised the alarm on the disease. In the same days, Ren Zhiqiang, a billionaire who was already a member of the Chinese Communist Party (CCP), was also targeted for referring to President Xi Jinping as a "power hungry clown".

Since February there has been no news even of Xu Zhangrun and He Weifang. The two intellectuals had criticized the regime, arguing that the lack of press freedom has favored the spread of the coronavirus. A Shandong university student, Zhang Wenbin, disappeared on March 30 after posting a video asking for Xi to resign.

Chen Zhaozhi, a retired professor at Beijing University of Science and Technology, was imprisoned in Beijing on April 14. He said that Covid-19 is not a "Chinese virus", but a "Chinese Communist Party virus", linking the origin and spread of the lung disease to the regime.

-- Zhang Zhan, a 'journalist citizen' who disappeared in Wuhan, arrested, by AsiaNews.it


They are reportedly being held in extrajudicial detention centers for speaking out about China’s response to the pandemic. They are usually accused of “picking quarrels and provoking trouble.”12

Another aspect of Chinese government secrecy involved in the SARS-CoV-2 pandemic relates to official reporting by Chinese government officials on the severity of the outbreak in China and on levels of mortality. The number of cases and deaths are suspected of being undercounted by at least an order of magnitude, and possibly two, meaning that the reported figures could be as little as one percent of the actual totals. In the last week of April 2020, Caixin, one of the most reliable publications in China, reported that a serological study had been carried out in Wuhan on 11,000 inhabitants. Extrapolating from its results, which showed that five to six percent of the sample of 11,000 persons carried antibodies for SARS-CoV-2, Caixin estimated that 500,000 people in the city had been infected, or 10 times the level of official Chinese government reporting. The publication was quickly deleted by Chinese government censors.13

The Chinese government has also attempted to obscure the origins of the pandemic with disinformation. On March 13, Chinese Foreign Ministry spokesperson Zhao Lijian suggested that the United States might have introduced the coronavirus to Wuhan.14


The US National Institutes of Health (NIH) funded bat-coronavirus research in the Wuhan Institute of Virology in China to the tune of US $3.7 million, a recent article in the British newspaper Daily Mail revealed.

Back in October 2014, the US government had placed a federal moratorium on gain-of-function (GOF) research -– altering natural pathogens to make them more deadly and infectious -– as a result of rising fears about a possible pandemic caused by an accidental or deliberate release of these genetically engineered monster germs.

This was in part due to lab accidents at the US Centers for Disease Control and Prevention (CDC) in July 2014 that raised questions about biosafety at US high-containment labs.

At that time, the CDC had closed two labs and halted some biological shipments in the wake of several incidents in which highly pathogenic microbes were mishandled by US government laboratories: an accidental shipment of live anthrax, the discovery of forgotten live smallpox samples and a newly revealed incident in which a dangerous influenza strain was accidentally shipped from the CDC to another lab.

A CDC internal report described how scientists failed to follow proper procedures to ensure samples were inactivated before they left the lab, and also found “multiple other problems” with operating procedures in the anthrax lab.

As such in October 2014, because of public health concerns, the US government banned all federal funding on efforts to weaponize three viruses –- influenza, Middle East respiratory syndrome (MERS) and severe acute respiratory syndrome (SARS).

In the face of a moratorium in the US, Dr Anthony Fauci –- the director of the National Institute of Allergy and Infectious Diseases (NIAID) and currently the leading doctor in the US Coronavirus Task Force –- outsourced in 2015 the GOF research to China’s Wuhan lab and licensed the lab to continue receiving US government funding...

Nonetheless, it is unclear what the legal ramifications would be if the virus was indeed leaked from a Chinese lab, but as a result of a research project that was outsourced and funded by the US government.

Also, if there was a government ban in 2014 on federal funding being used for GOF research, what are the federal compliance and ethical issues surrounding the fact that the NIH still gave federal funding instead of private funding to the Wuhan lab to continue the experiments?

Moreover, could some strains of the coronavirus have originated in U.S. labs, given the fact the US government lifted the ban in December 2017 on GOF research without resolving lab-safety issues?


-- Why US outsourced bat virus research to Wuhan: US-funded $3.7 million project approved by Trump's Covid-19 guru Dr Anthony Fauci in 2015 after US ban imposed on 'monster-germ' research, by Christina Lin


A month later, Zhao Lijian again posted Russian coronavirus and biowarfare-related disinformation, this time followed by online posts from Chinese ambassadors in 13 countries spread across the world.15

Meanwhile Chinese government officials have promoted baseless conspiracy theories about the virus’s origins, claiming that the United States military brought it to Wuhan. Zhao Lijian, a spokesperson for the Chinese Ministry of Foreign Affairs, retweeted one such article from the fringe conspiracy website Global Research.

-- Analyzing China’s Coronavirus Propaganda Messaging in Europe, by Matt Schrader


This was unprecedented diplomatic behavior for China, but not an accident. It was a concerted, deliberate, and preposterous disinformation campaign, repeated in May by CGTN, the China Global Television Network, which reposted the disinformation to the social media sites Weibo, Facebook, and Twitter.16 The history of Soviet and then Russian government biowarfare disinformation suggests that a country spreading such disinformation has or may have something to hide.17

You know Ralph, I think the public has not been in on this debate. It has been a secret debate with the NIH and other people who funded it. I think COVID-19 is a product of this. And I know Trump wants to call it the China virus. Well, the money that went into the creation and the genetic engineering of these coronaviruses in Wuhan was supported by the NIH and the USAID. So why wouldn't it be the NIH virus, or the USAID virus?

-- Interview with Andrew Kimball on the Ralph Nader Radio Show, Ralph Nader Radio Hour Episode 332


5. Laboratory accidents and the escape of highly dangerous pathogens from laboratories are frequent occurrences worldwide.

The accidental infection of researchers in the highest containment biosafety facilities—labelled BSL-2, BSL-3 and BSL-4—occurs worldwide, as do accidental releases by other means. In an excellent review published in February 2019, Lynn Klotz of the Center for Arms Control and Non-Proliferation noted that three releases of Ebola and Marburg viruses from BSL-4 and lower-containment facilities in the United States had occurred due to incomplete inactivation of cultures. Releases via infection of researchers took place in the highest containment facilities in the United States—at the Centers for Disease Control and Prevention (CDC) in Atlanta and at the US Army Medical Research Institute of Infectious Diseases (USAMRIID)—but in all cases only the researcher became ill, and there was no further transmission of the pathogen.

“In an analysis circulated at the 2017 meeting for the Biological Weapons Convention, a conservative estimate shows that the probability is about 20 percent for a release of a mammalian-airborne-transmissible, highly pathogenic avian influenza virus into the community from at least one of 10 labs over a 10-year period of developing and researching this type of pathogen,” Klotz wrote. “This percentage was calculated from FSAP [US Federal Select Agent Program] data for the years 2004 through 2010. Analysis of the FOIA NIH (National Institutes of Health) data gives a much higher release probability—that is, a factor five to 10 times higher, based on a smaller number of incident reports.”18


Between 2009 and 2015, the FSAP recorded 749 incidents in seven categories—not solely releases or researcher infections—from 276 facilities. In addition, Klotz recorded 11 confirmed releases of select agents that resulted in a laboratory-acquired infection in roughly 280 specifically approved laboratories in the United States between 2003 and 2017, a rate of just under one per year.19 A second publication in the Bulletin that covered closely-related subject matter and a personal communication from its author suggested that federally reported cases involving select agents were likely to be substantially undercounted:20

There is a fundamental problem of using the defined select agents as a surrogate for potential pandemic agent releases from research labs. The vast majority of ‘classical BW agents’ that initially defined select agents in the US were selected specifically to be NOT capable of sustained transmission so as to better define the military tactical limits of a military employment and because the establishment of progressive transmission was considered unpredictable and possibly counterproductive in military operations, at least on the US side of offensive development in the 1940s-1960s.

As my historical review of lab escapes that resulted in pandemics or wide area epidemics published in the BAS found, most pandemic, continental or large scale community outbreaks originating from lab escapes came from civilian labs working with public or veterinary pathogens of non-military interest.

It takes only one superspreading graduate student or maintenance worker to start a pandemic.


It is known that a very large percentage of the individuals infected with the SARS-CoV-2 virus show no symptoms and do not become clinically ill, which would facilitate an unrecognized infection of one or more laboratory researchers.

6. There have been laboratory accidents and escapes of highly dangerous pathogens in China in general and biosafety issues at the Wuhan Institute of Virology in particular.

After the SARS epidemic in 2002-2003, which originated naturally in China and which China initially kept secret, work on the coronavirus pathogen that was responsible for the outbreak was undertaken in laboratories around the world. This research led to six cases of infection in laboratory workers: four in the National Institute of Virology in Beijing and one each in laboratories in Singapore and Taiwan.

The laboratory-acquired infections of lab workers in Beijing led to short-lived outbreaks of SARS in the Beijing region in 2004.21

A second case of infected researchers in China resulted in brief outbreaks of disease in early December 2019. An outbreak of brucellosis began in an agricultural laboratory in Lanzhou (Gansu Province, central China) and spread to China’s premier bird flu laboratory in Harbin (Heilongjiang Province, northeast China). It was linked to index cases involving graduate students who were exposed while conducting research and included at least 96 people.22


7. Under what biosafety conditions was bat coronavirus research carried out at the Wuhan Institute of Virology?

Most work—including all published work using live bat coronaviruses that were not SARS-CoV and MERS-CoV—was conducted under BSL-2 conditions.23 This was consistent with both WHO and CDC recommendations.24 BSL-2 provides only minimal protection against infection of laboratory researchers, and these regulations were almost certainly too lenient for working with bat coronaviruses. All such work should have been carried out under BSL-3 conditions. However, extremely high-risk gain of function (GoF) studies with bat SARS-related coronaviruses were carried out at BSL-3 or BSL-4. Statements made by various commentators claiming that the WIV worked only with RNA isolates and not with live viruses are untrue (as discussed in further detail in a following section).
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 4:25 am

Part 2 of 2

In regard to the Wuhan Institute of Virology in particular, relevant information is again available from both Chinese and Western sources. Information from official Chinese government sources appeared in a Voice of America report which noted:

[T]here is Chinese evidence that the lab had safety problems. VOA has located state media reports showing that there were security incidents flagged by national inspections as well as reported accidents that occurred when workers were trying to catch bats for study.

About a year before the corona virus outbreak, a security review conducted by a Chinese national team found the lab did not meet national standards in five categories.


The document on the lab’s official website said after a rigorous and meticulous review, the team gave a high evaluation of the lab’s overall safety management. “At the same time, the review team also put forward further rectification opinions on the five non-conformities and two observations found during the review.”
In addition to problems in the lab, state media also reported that national reviewers found scientists were sloppy when they were handling bats.

One of the researchers working at the Wuhan Center for Disease Control & Prevention described to China’s state media that he was once attacked by bats, and he ended up getting bat blood on his skin.

In another incident, the same researcher forgot to take protective measures, and the urine of a bat dripped “like rain onto the top of his head,” reported China’s Xinhua state news agent.
25


Also, information was leaked from the US Department of State and published in the Washington Post on April 14:

Two years before the novel coronavirus pandemic upended the world, U.S. Embassy officials visited a Chinese research facility in the city of Wuhan several times and sent two official warnings back to Washington about inadequate safety at the lab, which was conducting risky studies on corona viruses from bats. The cables have fueled discussions inside the U.S. government about whether this or another Wuhan lab was the source of the virus -– even though conclusive proof has yet to emerge.

In January 2018, the U.S. Embassy in Beijing took the unusual step of repeatedly sending U.S. science diplomats to the Wuhan Institute of Virology, which had in 2015 become China’s first laboratory to achieve the highest level of international bioresearch safety (known as BSL-4). WIV issued a news release in English about the last of these visits, which occurred on March 27, 2018. The U.S. delegation was led by Jamison Fouss, the consul general in Wuhan, and Rick Switzer, the embassy’s counselor of environment, science, technology and health. Last week, WIV erased that statement from its website, though it remains archived on the Internet.

What the U.S. officials learned during their visits concerned them so much that they dispatched two diplomatic cables categorized as Sensitive But Unclassified back to Washington. The cables warned about safety and management weaknesses at the WIV lab and proposed more attention and help. The first cable … also warns that the lab’s work on bat coronaviruses and their potential human transmission represented a risk of a new SARS-like pandemic.

“During interactions with scientists at the WIV laboratory, they noted the new lab has a serious shortage of appropriately trained technicians and investigators needed to safely operate this high-containment laboratory,”
states the Jan. 19, 2018, cable, which was drafted by two officials from the embassy’s environment, science and health sections who met with the WIV scientists.

[MATERIAL OMITTED AT THIS POINT BY AUTHOR MILTON LEITENBERG WHEN QUOTING THIS ARTICLE] (The State Department declined to comment on this and other details of the story.)

The Chinese researchers at WIV were receiving assistance from the Galveston National Laboratory at the University of Texas Medical Branch and other U.S. organizations, but the Chinese requested additional help. The cables argued that the United States should give the Wuhan lab further support, mainly because its research on bat coronaviruses was important but also dangerous.

As the cable noted, the U.S. visitors met with Shi Zhengli, the head of the research project, who had been publishing studies related to bat coronaviruses for many years. In November 2017, just before the U.S. officials’ visit, Shi’s team had published research showing that horseshoe bats they had collected from a cave in Yunnan province were very likely from the same bat population that spawned the SARS coronavirus in 2003.


“Most importantly,” the cable states, “the researchers also showed that various SARS-like coronaviruses can interact with ACE2, the human receptor identified for SARS-coronavirus. This finding strongly suggests that SARS-like coronaviruses from bats can be transmitted to humans to cause SARS-like diseases. From a public health perspective, this makes the continued surveillance of SARS-like coronaviruses in bats and study of the animal-human interface critical to future emerging coronavirus outbreak prediction and prevention.26


The US government had supplied a portion of the funds to build the Wuhan Institute of Virology and these cables were an appeal for funds to support additional training in biosafety and biosecurity. There were similar concerns about the nearby Wuhan Center for Disease Control and Prevention lab, which operates entirely at BSL-2. Chinese government authorities did not provide the US government with samples of the virus obtained from either the earliest cases or from the Wuhan fish market. A US intelligence official commented: “The idea that it was just a totally natural occurrence is circumstantial. The evidence it leaked from the lab is circumstantial. Right now, the ledger on the side of it leaking from the lab is packed with bullet points, and there’s almost nothing on the other side.”27

8. What is the nature of the research being carried out in Zhengli Shi’s laboratory at the Wuhan Institute of Virology?

Details of the most recent National Institute of Allergy and Infectious Diseases (NIAID) grant for WIV bat coronavirus surveillance and WIV bat coronavirus gain of function research are publicly available. The key activity for bat coronavirus surveillance is “Aim 1 … We will sequence receptor binding domains (spike proteins) to identify viruses with the highest potential for spillover which we will include in our experimental investigations (Aim 3).” The key activity for bat coronavirus gain of function investigation is “Aim 3…. We will use S protein sequence data, infectious clone technology, in vitro and in vivo infection experiments, and analysis of receptor binding to test the hypothesis that % divergence thresholds in S protein sequences predict spillover potential.”28

Translated into something approaching lay language, Aim 3 states that de novo synthesis is to be used to construct a series of novel chimeric viruses, comprising recombinant hybrids using different spike proteins from each of a series of unpublished natural coronaviruses in an otherwise-constant genome of a bat coronavirus. The ability of the resulting novel viruses to infect human cells in culture and to infect laboratory animals would be tested. The underlying hypothesis is that a direct correlation would be found between the receptor-binding affinity of the spike protein and the ability to infect human cells in culture and to infect laboratory animals. This hypothesis would be tested by asking whether novel viruses encoding spike proteins with the highest receptor-binding affinity have the highest ability to infect human cells in culture and laboratory animals.

The WIV began its gain of function research program for bat coronaviruses in 2015. Using a natural virus, institute researchers made “substitutions in its RNA coding to make it more transmissible. They took a piece of the original SARS virus and inserted a snippet from a SARS-like bat coronavirus, resulting in a virus that is capable of infecting human cells.”29 This meant it could be transmitted from experimental animal to experimental animal by aerosol transmission, which means that it could do the same for humans. In other words, gain of function techniques were used to turn bat coronaviruses into human pathogens capable of causing a global pandemic.


There have been three publications, in 2015,30 2016 and 2017, describing the WIV gain of function research. The WIV, having learned both basic and traceless infectious-clone technology from joint research with a laboratory at the University of North Carolina (UNC) in 2015, initiated construction of novel chimeric coronaviruses without UNC immediately thereafter. WIV’s first publication on the use of basic infectious-clone technology to construct novel chimeric coronaviruses at WIV appeared in 2016.31 WIV’s first publication on the use of traceless, signature-free infectious-clone technology also appeared in 2016.32

As this article was being edited, two excellent publications appeared that provide greater technical detail on WIV’s gain of function research, and readers should certainly examine these with care.33 The two papers strongly support the argument that the SARS-CoV-2 outbreak was the results of an escape from one of the two Chinese virology laboratories in Wuhan.

The Chinese government has proudly stated that the WIV “preserves more than 1,500 strains of virus,” the largest collection in Asia of bat and other coronaviruses.34 (The government statement probably should have said 1,500 isolates rather than “strains.”) The 2019 interview with Shi in Scientific American reports that the WIV had at least hundreds of individual strains.35 These numbers have been reported by Chinese government authorities, and they are being taken at face value here.

[O]n April 16th Peter Daszak, who is the President of the EcoHealth Alliance, told Democracy Now! in a lengthy interview that the lab escape thesis was “Pure baloney”. He told listeners:

“There was no viral isolate in the lab. There was no cultured virus that’s anything related to SARS coronavirus 2. So it’s just not possible...”

Daszak is the named principal investigator on multiple US grants that went to the Shi lab at WIV. He is also a co-author on numerous papers with Zheng-Li Shi, including the 2013 Nature paper announcing the isolation of coronavirus WIV-1 through passaging (Ge et al., 2013). One of his co-authorships is on the collecting paper in which his WIV colleagues placed the four fully functional bat coronaviruses into human cells containing the ACE2 receptor (Hu et al. 2017). That is, Daszak and Shi together are collaborators and co-responsible for most of the published high-risk collecting and experimentation at the WIV.

If the Shi lab has anything to hide, it is not only the Chinese Government that will be reluctant to see an impartial investigation proceed. Much of the work was funded by the US taxpayer, channeled there by Peter Daszak and the EcoHealth Alliance. Virtually every credible international organisation that might in principle carry out such an investigation, the WHO, the US CDC, the FAO, the US NIH, including the Gates Foundation, is either an advisor to, or a partner of, the EcoHealth Alliance. If the Sars-CoV-2 outbreak originated from the bat coronavirus work at the WIV then just about every major institution in the global public health community is implicated.

-- The Case Is Building That COVID-19 Had a Lab Origin, by Jonathan Latham, PhD and Allison Wilson, PhD


From 2004 on, the WIV published many dozens of partial or full genome sequences of coronaviruses in their collection. On June 1, Daszak and Shi published partial genetic sequences of 781 Chinese bat coronaviruses, more than one-third of which had never been published previously.36 There are also multiple published records of animal infection research with bat coronaviruses at the WIV. In order to carry out the research program described above, the WIV laboratory needs to use live viruses, and not just RNA fragments. This contradicts two of the assertions, made by some commentators, that Shi worked only with RNA fragments and that her laboratory did not maintain live viruses. On May 24, 2020, the director of the WIV acknowledged that the laboratory did have “three live strains of bat corona viruses on site,” but implied only three.37 Knowledgeable virologists assume that the number must be much higher, probably hundreds of live viral isolates.38

It is precisely in the course of the kind of gain of function research that the WIV conducted that there would be the greatest likelihood of infection of a laboratory researcher.
Many commentators have noted that millions of people in several western Chinese provinces, as well as in other South Asian countries, live their lives in daily proximity to bat caves and that serological testing has shown a fraction of these villagers to have antibodies to bat coronaviruses, showing that natural infection had occurred. The commentators argue therefore that “the odds” are in favor of SARS-CoV-2 having arisen in the field, and that a laboratory escape is so implausible that it is out of consideration. The logic of “the odds” is specious: It would take only a single laboratory infection to overcome “the odds,” if such could in fact be reckoned. That is essentially what happened in the four SARS laboratory infections that occurred in the Beijing laboratory in 2004; “the odds” for exposure of villagers in Yunnan province were irrelevant.

Since the SARS-CoV-2 genome was decoded and published, there have been numerous statements from virologists that the genome shows no indication of genetic manipulation, and that this too supports the argument that it arose in the field and did not escape from a laboratory. Although this argument implicitly recognizes that the WIV laboratory was using genetic engineering technology, there is no reason to arbitrarily assume that only a bat coronavirus that was genetically modified might have escaped from the laboratory. Nevertheless, the second portion of the NIAID research grant design made absolutely clear that the WIV would be applying genetic engineering techniques to bat coronaviruses. Using the current standard genetic engineering technology, many alterations of several bases in the RNA genome would be undetectable, including construction of a chimeric coronavirus encoding an unpublished spike protein in an unpublished genome. This would be the equivalent of a natural mutation in several bases that coded for the spike proteins.

An article in Independent Science News by Jonathan Latham and Allison Wilson discusses another mechanism, described by Nikolai Petrovsky of Flinders University in Australia, that could have resulted in the SARS-CoV-2 virus that produced the pandemic:

Take a bat coronavirus that is not infectious to humans, and force its selection by culturing it with cells that express human ACE2 receptor, such cells having been created many years ago to culture SARS coronaviruses and you can force the bat virus to adapt to infect human cells via mutations in its spike protein, which would have the effect of increasing the strength of its binding to human ACE2, and inevitably reducing the strength of its binding to bat ACE2.

Viruses in prolonged culture will also develop other random mutations that do not affect its function. The result of these experiments is a virus that is highly virulent in humans but is sufficiently different that it no longer resembles the original bat virus. Because the mutations are acquired randomly by selection there is no signature of a human gene jockey, but this is clearly a virus still created by human intervention.
39


Final comments.

On April 30 [April 27], Newsweek described a report produced by the US Defense Intelligence Agency which stated that “in early February, China’s Academy for Military Medical Sciences ‘concluded that it was impossible for them to scientifically determine whether the Covid-19 outbreak was caused naturally or accidentally from a laboratory incident.’” The author of a newly published paper analyzing the genome of SARS-COV-2 reported that “the COVID-19 virus is exquisitely adapted to infect humans… The virus’s ability to bind protein on human cells was far greater than its ability to bind the same protein in bats, which argues against bats being a direct source of the human virus.”40

The study, led by Flinders University scientists, compared the modeling to the virus's ability to bind to human cells and found the SARS-CoV-2 virus targets humans more potently than any of the tested animal species.

"The results clearly show that the COVID-19 virus is exquisitely adapted to infect humans," says Flinders University Professor Nikolai Petrovsky, lead author of a new paper just published online in arXiv, a leading US preprint server for researchers.

"The virus's ability to bind protein on human cells was far greater than its ability to bind the same protein in bats, which argues against bats being a direct source of the human virus."


The team's computer modeling shows the SARS-CoV-2 virus also bound strongly to cells of pangolins, an exotic ant-eater illegally imported into China.

"While it has been suggested by some Chinese scientists that the COVID-19 virus might have been transmitted to humans from pangolins, currently available data does not support this idea," Professor Petrovsky says...

The article, 'In silico comparison of spike protein-ACE2 binding affinities across species; significance for the possible origin of the SARS-CoV-2 virus' (2020) has been published on the arXiv pre-press server.

-- Origins of COVID-19 still a mystery, by Flinders University


Overall, the data indicates that SARS-CoV-2 is uniquely adapted to infect humans, raising important questions as to whether it arose in nature by a rare chance event or whether its origins might lie elsewhere.

Geng Shuang, a spokesman for the Chinese Ministry of Foreign Affairs, said. “China has mentioned many times that the origin of the virus is a scientific question, which should be evaluated by scientists and medical experts, and should not be politicized.”41 Essentially the same position on the possibility that a lab leak originated the pandemic was expressed by Xiao Qiang, a research scientist at the School of Information at the University of California, Berkeley. “I don’t think it is a conspiracy theory. I think it’s a legitimate question that needs to be investigated and answered. To understand exactly how this originated is critical knowledge for preventing this from happening in the future.”42

But Chinese officials reacted angrily in April when Australian officials suggested that the World Health Organization should be able to quickly investigate a disease outbreak that could lead to a pandemic, retaliating by instituting trade restrictions on several Australian agricultural exports to China. In early May, the World Health Organization’s representative in China, Gauden Galea, publicly complained that China had refused repeated requests to permit the WHO to participate in whatever investigations the Chinese government was undertaking itself. He said that the WHO had not been given access to laboratory logs at the WIV or the Wuhan Chinese Center for Disease Control and Prevention.43

On May 18, prior to a meeting of the WHO governing board, the European Union submitted a draft resolution supported by 100 nations that asked the WHO “to work with other United Nations agencies to ‘identify the zoonotic source of the virus and the route of introduction to the human population, including the possible role of intermediate hosts. … The document does not propose a review to identify missteps in how countries handled the outbreak and is instead forward-looking. It calls on the WHO to potentially arrange ‘scientific and collaborative field missions’ to help prevent similar future outbreaks. It also appears to rule out the possibility that the virus was man-made or experimented upon.”44

The draft resolution did not mention Wuhan or China.45


On May 18, China’s President Xi addressed the meeting of the governing body of the WHO via video. Ironically, Xi asked that countries “step up information sharing” but declared that China would support a review of the pandemic led by the WHO as long as it was “objective and impartial” and held after the pandemic was under control or over. The operative WHO resolution focuses on identifying “the zoonotic source of the virus” and says nothing about any forensic investigation.46 The Chinese Foreign Ministry spokesman Zhao Lijian declared that “China supported an international inquiry all along,” and China’s Global Times asked: “Will China oppose scientific research into the virus’ origin? No, because it is a necessary move to fight COVID-19 in a scientific way and conducive to prevention measures and development of vaccines and medicine,” but added “Not only China-related factors but also those related to the US and other countries need to be included. Earlier confirmed cases than the previously known first infected case have continuously been found in the US. Among those diagnosed as having flu last winter, how many were coronavirus infections? All these clues shouldn’t be missed.”47

What does this all mean at the present time? We have in China:

• a record of laboratory escape of the SARS virus in 2004 from a premier Chinese research institute.
• a record of poor biosafety in some of its high-containment facilities, including in the Wuhan institutes.
• a record of suppression of information in general, and in the case of SARS-CoV-2 in particular.
• the initiation of a disinformation campaign in regard to the origin of SARS-CoV-2, targeting US biological laboratories.
• a record of gain of function research at the Wuhan Institute of Virology, including passage of a bat coronavirus construct through experimental animals.

Writing in the Bulletin of the Atomic Scientists before the WHO governing board was convened, Filippa Lentzos advocated for a forensic investigation and described what it would entail:

Investigating the range of possible spillover sites—from the wet market, to an accidental lab or fieldwork infection, or an unnoticed lab leak—requires a forensic investigation. Obtaining case histories, epidemiological data, and viral samples from different times and places, including the earliest possible samples from infected individuals and samples from wildlife, is paramount… A forensic investigation would additionally involve auditing and sampling viral collections at relevant labs that had been studying coronaviruses, examining the types of experiments carried out and the viruses used, and reviewing the safety and security practices in place. Key data would also come from documents, including standard operating procedures at the labs and during fieldwork, risk assessments of individual experiments, experiment logs and fieldwork notebooks, training records, waste management logs, accident and infection records, facility maintenance and automated systems records, access logs, security camera footage and communications logs. …A COVID-19 origins investigation will need to be negotiated and begun rapidly before relevant data diminishes or disappears entirely as time passes.48


There is no semblance of any of this in the WHO resolution, and one can scarcely imagine that any of it would be permitted by the current administration in China. An investigation held after the pandemic “is under control” cannot possibly be carried out “rapidly,” and is in fact postponed into the indefinite future.
Unfortunately, if there were any documentation in either of the two Wuhan virology institutes that recorded the infection of a laboratory researcher or an escape, or that either had a virus sample that was extremely similar to SARS-CoV-2, one has to assume that such information has already been removed or destroyed.


Others have suggested that an international “commission, independent of the WHO, needs to be set up with the broad objective of how to ameliorate the next pandemic. Its mandate should go well beyond that of the WHO and part of its work could be to look at how COVID-19 started.”49 Unfortunately it is equally difficult to envision such a commission coming to pass.

At present, the origin of SARS-CoV-2 remains unknown. The pros and cons regarding the two alternative possibilities—first, that it arose in the field as a natural evolution, as many virologists maintain, or second, that it may have been the consequence of bat coronavirus research in one of the two virology research institutes located in Wuhan that led to the infection of a laboratory researcher and subsequent escape—are equally based on inference and conjecture. The points gathered in this paper can be no more than suggestive. There is no hard scientific evidence to support either position.



Both are inferences from circumstantial evidence. The US administration’s political hectoring only assures that it will be very difficult if not impossible to ever find out which is true.

Acknowledgements:

The author would like to thank several colleagues with far-better computer skills than he has for supplying many of the electronic references. I would also like to thank several colleagues for reading and commenting on the paper. This manuscript was submitted for publication on May 27, 2020.

Notes

1 Shane Harris et al, “Intelligence officials’ early alarms about possible pandemic went unheeded,” Washington Post, March 21, 2020; Eric Lipton et al, “Despite timely alerts, Trump was slow to act,” New York Times, April 12, 2020; Philip Rucker et al, “As deaths mounted, Trump fixated on stalled economy,” Washington Post, May 3, 2020; Edward Luce, “Inside Trump’s Corona Virus Meltdown,” Financial Times Magazine, May 14, 2020; Fintan O’Toole, “Vector in Chief,” New York Review of Books, 67:8, May 14, 2020; and Fintan O’Toole, “Donald Trump has destroyed the country he promised to make great again,” Irish Times, April 25, 2020.
2 See https://www.scmp.com/news/china/society ... se-system; https://www.bloomberg.com/news/articles ... re-meeting.
3 Liu Caiyu and Leng Shumai, “Biosafety guidelines issued to fix chronic management loopholes at virus labs,” Global Times, February 16, 2020, https://www.globaltimes.cn/content/1179747.shtml.
4 Liu Caiyu and Leng Shumai, “Biosafety guidelines issued to fix chronic management loopholes at virus labs,” Global Times, February 16, 2020, https://www.globaltimes.cn/content/1179747.shtml, and Yuan Zhiming, “Current status and future challenges of high-level biosafety laboratories in China, Journal of Biosafety and Biosecurity, Volume 1, Issue 2, September 2019, pp. 123-127. Accessed at: https://doi.org/10.1016/j.jobb.2019.09.005.
5 Shing Hei Zhan, Benjamin E. Deverman and Yujia Alina Chan, “SARS-CoV-2 is well adapted for humans. What does this mean for re-emergence?” BioRxiv, posted May 2, 2020 on: https://doi.org/10.1101/2020.05.01.073262.
6 Chaolin Huang Yeming Wang, Xingwang Li, Lili Ren, Jianping Zhao, Yi Hu, Li Zhang et al, “Clinical Features of Patients Infected with 2019 Novel Coronavirus in Wuhan, China,” The Lancet, Vol. 395, no. 10223 (February 15, 2020): 497-506, https://doi.org/10.1016/S0140-6736(20)30183-5.
7 James T. Areddy, “China rules out Animal Market and Lab as Coronavirus origin,” Wall Street Journal, May 26, 2020, https://www.wsj.com/articles/china-rule ... 1590517508.
8 “Wuhan’s seafood market a victim of COVID-19: CDC director,” Global Times [China], May 26, 2020, https://www.globaltimes.cn/content/1189506.shtml.
9 Botao Xiao and Lei Xiao, “The possible origins of 2091-nCoV coronavirus,” https://img-prod.tgcom24.mediaset.it/im ... da0204.pdf.
10 Jon Cohen, “Chinese researchers reveal draft genome of virus implicated in Wuhan pneumonia outbreak,” Science, January 11, 2020, https://www.sciencemag.org/news/2020/01 ... a-outbreak.
11 Christian Shepherd and Don Weinland, “China Rounds up Wuhan’s Citizen Journalists for ‘Provoking Quarrels’,” Financial Times, May 28, 2020, https://www.ft.com/content/3fd5c031-215 ... 71f6ecf64; Aylin Woodward, “At least 5 people in China have disappeared, gotten arrested, or been silenced after speaking out about the coronavirus — here’s what we know about them,” Business Insider, February 20, 2020, https://businessinsider.com/china-coron ... sh-2020-2; “Coronavirus: Wuhan doctor speaks out against authorities,” The Guardian, March 11, 2020, https://www.theguardian.com/world/2020/ ... thorities; Scott Neuman, Emily Feng and Huojingnan, “China To Investigate After Whistleblower Doctor Dies From Coronavirus,” February 7, 2020, https://www.npr.org/sections/goatsandso ... ronavirus; Verna Yu, “’Hero who told the truth’: Chinese rage over coronavirus death of whistleblower doctor,” The Guardian, February 7, 2020, https://wwwthe.guardian.com/global-deve ... i-wenliang.
12 “A 4th Chinese citizen journalist was reportedly detained after livestreaming what life was like in Wuhan at the height of its coronavirus outbreak,” Business Insider, https://www.businessinsider.com/zhang-z ... han-2020-5. This paper does not attempt to resolve allegations that have been published claiming that a former graduate student at the WIV, Huang Yan Ling, was the index case and subsequently died or disappeared. The allegations have been denied by the Chinese government as well as by members of the WIV staff. Jun Mai, “Chinese research lab denies rumours of links to first coronavirus patient,” South China Morning Post, February 16, 2020, https://www.scmp.com/news/china/society ... oronavirus.
13 Keoni Everington, “Chinese Media Estimates 500,000 Coronavirus Cases in Wuhan, Quickly deletes News,” Taiwan News, May 19, 2020, https://www.taiwannews.com.tw/en/news/3936718.
14 Elise Thomas, “Chinese diplomats and Western fringe media outlets push the same coronavirus conspiracies,” Australian Strategic Policy Institute, March 24, 2020, https://www.aspistrategist.org.au/chine ... spiracies/. The “Western fringe media” were reposting earlier Russian disinformation posts.
15 Matt Schrader, “Analyzing China’s Coronavirus Propaganda Messaging in Europe,” https://securingdemocracy.gmfus.org/ana ... in-europe/.
16 CGTN, “US operates over 200 military biological laboratories worldwide,” 21 May 2020, https://news.cgtn.com/news/2020-05-21/U ... index.html.
17 Milton Leitenberg, “ Russian Disinformation Campaigns re Biological Weapons in the Putin Era,” https://cissm.umd.edu/sites/default/fil ... utin%20PPT
%2011%20Dec%202019_Rev%208%20May%202020.pdf.
18 Lynn Klotz, “Human error in high-biocontainment labs: a likely pandemic threat,” Bulletin of the Atomic Scientists, February 25, 2019.
19 Lynn Klotz, “The risk of lab-created potential pandemic influenza,” March 2020, https://armscontrolcenter.org/wp-conten ... at-end.pdf.
20 Martin Furmanski, “Threatened pandemics and laboratory escapes: Self-fulfilling prophecies,” Bulletin of the Atomic Scientists, March 31, 2014 and Martin Furmanski, personal communication, May 29, 2020.
21 Robert Walgate, “SARS escaped Beijing lab twice: Laboratory safety at the Chinese Institute of Virology under close scrutiny,” The Scientist, April 24, 2004, https://www.the-scientist.com/news-anal ... wice-50137.
22 Rosie McCall, “Almost 100 Lab Workers in China Infected With Potentially Deadly Pathogen,” Newsweek, December 17, 2019, https://www.newsweek.com/almost-100-lab ... en-1477652.
23 Lei-Ping Zeng et al, “Bat SARS-like coronavirus WIV1 encodes an extra accessory protein ORFX involved in modulation of host immune response,” Journal of Virology 2016 May 11:JVI-03079, https://jvi.asm.org/content/jvi/early/2 ... 5.full.pdf.
24 Laboratory biorisk management for laboratories handling human specimens suspected or confirmed to contain novel coronavirus: Interim recommendations, https://www.who.int/csr/disease/coronav ... endations_
NovelCoronavirus_19Feb13.pdf; Centers for Disease Control and Prevention, “Appendix F5— Laboratory Biosafety Guidelines for Handling and Processing Specimens Associated with SARS-CoV. Supplement F: Laboratory Guidance. Public Health Guidance for Community-Level Preparedness and Response to Severe Acute Respiratory Syndrome (SARS) Version 2/3,” https://www.cdc.gov/sars/guidance/f-lab/app5.html.
25 John Xie, “Chinese Lab with Checkered Safety Record Draws Scrutiny over Covid-19,” VOA News, April 21, 2020, https://www.voanews.com/covid-19-pandem ... r-covid-19.
26 Josh Rogin, “State Department cables warned of safety issues at Wuhan lab studying bat coronaviruses,” Washington Post, April 14, 2020.
27 Josh Rogin, “State Department cables warned of safety issues at Wuhan lab studying bat coronaviruses.” A press item reported that an alleged 15-page “Five Eyes” intelligence report shared among the US, UK, Australia, Canada and New Zealand validated many of the charges against the WIV. Dave Makichuk, “Dossier an indictment of China’s virus response,” The Saturday Telegraph [UK], May 3, 2020. However, the Australian government announced that the “report” had been prepared from open source materials by the US alone, was not an agreed intelligence report, and was leaked by the US embassy to a Rupert Murdoch publication. Anthony Galloway and Eryk Bagshaw, “Australian intelligence knocks back US government’s Wuhan lab virus claim,” Sydney Morning Herald, May 4, 2020, https://www.smh.com.au/politics/federal ... 4pk3.html; Anthony Galloway and Eryk Bagshaw, “Australian concern over US spreading unfounded claims about Wuhan lab,” Sydney Morning Herald, May 7, 2020, https://www.smh.com.au/politics/federal ... 54qhp.html.
28 See https://projectreporter.nih.gov/project ... ASC&pball=
29 Fred Guteri et al, “The Controversial Experiments and Wuhan Lab suspected of Starting Pandemic,” Newsweek, April 30, 2020.
30 Vineet D. Menachery et al, “A SARS-like Cluster of Circulating Bat Coronaviruses Shows Potential for Human Emergence,” Nat Med. 2015 Dec; 21(12):1508-13. doi: 10.1038/nm.3985. Epub 2015 Nov 9, https://pubmed.ncbi.nlm.nih.gov/26552008/.
31 LP Zeng et al, “Bat Severe Acute Respiratory Syndrome-Like Coronavirus WIV1 Encodes an Extra Accessory Protein, ORFX, Involved in Modulation of the Host Immune Response,” J Virol. 2016 Jun 24;90(14):6573-6582. doi: 10.1128/JVI.03079-15. Print 2016 Jul 15, (methods for construction of chimeric coronaviruses, https://pmlegacy.ncbi.nlm.nih.gov/pubmed/27170748.
32 B. Hu et al, “Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus,” PLoS Pathog. 2017 Nov 30;13(11):e1006698. doi: 10.1371/journal.ppat.1006698. eCollection 2017 Nov, (construction of chimeric coronaviruses encoding different S proteins), https://pmlegacy.ncbi.nlm.nih.gov/pubmed/29190287.
33 Yuri Deigin, “Lab-Made? SARS-CoV-2 Genealogy Through the Lens of Gain-of-Function Research, April 22, 2020, https://medium.com/@yurideigin/lab-made ... 6dd7413748 and Jonathan Latham and Allison Wilson, “The Case is Building That COVID-19 Had a Lab Origin,” Independent Science News, June 2, 2020, https://www.independentsciencenews.org/ ... ab-origin/.
34 Wuhan Institute of Virology, CAS, “Take a look at the largest virus bank in Asia,” 2018, http://english.whiov.cas.cn/ne/201806/t ... 93863.html.
35 Jane Qiu, “How China’s ‘Bat Woman’ Hunted Down Viruses from SARS to the New Coronavirus,” Scientific American, June 2020, https://www.scientificamerican.com/arti ... onavirus1/
36 Jon Cohen and Kai Kupferschmidt, “NIH-halted study unveils ist massive analysis of bat coronaviruses,” Science, June 2, 2020, https://www.sciencemag.org/news/2020/06 ... onaviruses.
37 Agence France Presse, “Wuhan lab had three live bat coronaviruses: Chinese state media,” May 24, 2020, https://au.news.yahoo.com/wuhan-lab-had ... -033127925–spt.html.
38 Personal communication, May 24, 2020.
39 Jonathan Latham and Allison Wilson, “The Case is Building That COVID-19 Had a Lab Origin,” Independent Science News, June 2, 2020, https://www.independentsciencenews.org/ ... ab-origin/.
40 Press Release, Flinders University, “Origins of COVID-19 still a mystery”, May 14, 2020; Sakshi Piplani et al, “In Silico Comparison of Spike Protein-ACE2 Binding Affinities across Species: Significance for the Possible Origin of the SARS-CoV-2 Virus,” ArXiv:2005.06199 [q-Bio], May 13, 2020, http://arxiv.org/abs/2005.06199. See also, Jeremy Andre, “Origine du coronavirus: ‘L’Infection d’un employé de laboratoire de Wuhan est plus probable’,” Le Point International, April 18, 2020 and Jef Akst, “Lab-Made Coronavirus Triggers Debate,” The Scientist, November 16, 2015 (updated March 11, 2020), https://www.the-scientist.com/news-opin ... bate-34502.
41 John Xie, “Chinese Lab with Checkered Safety Record Draws Scrutiny over COVID-19,” VOA News, April 21, 2020, https://www.voanews.com/covid-19-pandem ... r-covid-19.
42 Kenneth Rapoza, “China Lab in Focus of Corona Virus Outbreak,” Forbes, April 14, 2020, https://www.forbes.com/sites/kenrapoza/ ... -outbreak/.
43 Patrick Smith, “WHO official says agency not invited to take part in China’s coronavirus investigation,” NBC News, May 1, 2020, https://nbcnews.com/news/world/who-offi ... s-n1197516.
44 Gerry Shih, “China’s Xi backs WHO-led review of covid-19 outbreak, proposes aid for developing world,” Washington Post, May 18, 2020, https://www.washingtonpost.com/world/as ... story.html.
45 Gerry Shih, “China’s Xi backs WHO-led review of covid-19 outbreak, proposes aid for developing world,” Washington Post, May 18, 2020, https://www.washingtonpost.com/world/as ... story.html.
46 WHO, Draft Resolution: COVID-19 response, A73/CONF./1 Rev.1, May 18, 2020, https://apps.who.int/gb/ebwha/pdf_files ... ev1-en.pdf.
47 “Editorial: Virus investigation must be fair, scientific,” Global Times, May 17, 2020, https://www.globaltimes.cn/content/1188620.shtml. On May 4, 2020, a Chinese Hsinhua publication asked the question “Where did the virus in the U.S. originate?”: “On March 11, CDC Director Robert Redford told a hearing on Capitol Hill that some COVID-19 deaths have been diagnosed as flu-related in the United States. Washington needs to clarify the number of COVID-19 cases previously diagnosed as flu, and make public the samples and genetic sequence of the influenza virus in the country.” “Spotlight: Five Questions Washington needs to answer on coronavirus pandemic,” XINHUANET, May 4, 2020.
48 Filippa Lentzos, “Will the WHO call for an international investigation into the coronavirus’s origins?”, The Bulletin of the Atomic Scientists, May 18, 2020.
49 Personal communication, Rod Barton, May 25, 2020.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 5:57 am

Human error in high-biocontainment labs: a likely pandemic threat
by Lynn Klotz
Bulletin of the Atomic Scientists
February 25, 2019

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.



Image
A CDC staff microbiologist examines reconstructed 1918 Pandemic Influenza Virus at a Biosafety Level 3-enhanced lab. Photo Credit: James Gathany/CDC

Incidents causing potential exposures to pathogens occur frequently in the high security laboratories often known by their acronyms, BSL3 (Biosafety Level 3) and BSL4. Lab incidents that lead to undetected or unreported laboratory-acquired infections can lead to the release of a disease into the community outside the lab; lab workers with such infections will leave work carrying the pathogen with them. If the agent involved were a potential pandemic pathogen, such a community release could lead to a worldwide pandemic with many fatalities. Of greatest concern is a release of a lab-created, mammalian-airborne-transmissible, highly pathogenic avian influenza virus, such as the airborne-transmissible H5N1 viruses created in the laboratories of Ron Fouchier in the Netherlands and Yoshihiro Kawaoka In Madison Wisconsin.

[T]wo researchers, Ron Fouchier who's up at the University of Erasmus in Netherlands, and Yoshihiro Kawaoka who is a researcher at University of Wisconsin, they said, "You know what, this isn't very infective, this bird flu. What if we were able to create a version that is airborne? You could get like the common cold. Let's try that." And they did. They actually were able to create this virus. So if this virus escapes, right, 1.6 billion people could die, 60% of the world's population. Well, this caused a huge furor. In 2014, the Obama administration actually declared a moratorium on this gain of function-gain of threat... They said, "This is just too dangerous."

-- Interview with Andrew Kimball on the Ralph Nader Radio Show, July 18, 2020


Such releases are fairly likely over time, as there are at least 14 labs (mostly in Asia) now carrying out this research. Whatever release probability the world is gambling with, it is clearly far too high a risk to human lives. Mammal-transmissible bird flu research poses a real danger of a worldwide pandemic that could kill human beings on a vast scale.

Human error is the main cause of potential exposures of lab workers to pathogens. Statistical data from two sources show that human error was the cause of, according to my research, 67 percent and 79.3 percent of incidents leading to potential exposures in BSL3 labs. These percentages come from analysis of years of incident data from the Federal Select Agent Program (FSAP) and from the National Institutes of Health (NIH). (Details may be found in the Supplementary Material document.)

Understanding human error is important to calculating the probability that a pathogen will be released from a lab into the surrounding community, the first step in calculating the likelihood of a pandemic. A key observation is that human error in the lab is mostly independent of pathogen type and biosafety level. Analyzing the likelihood of release from laboratories researching less virulent or transmissible pathogens therefore can serve as a reasonable surrogate for how potential pandemic pathogens are handled. (We are forced to deal with surrogate data because, thank goodness, there are little data on the release of potentially pandemic agents.) Put another way, surrogate data allows us to determine with confidence the probability of release of a potentially pandemic pathogen into the community. In a 2015 publication, Fouchier describes the careful design of his BSL3+ laboratory in Rotterdam and its standard operating procedures, which he contends should increase biosafety and reduce human error. Most of Fouchier’s discussion, however, addresses mechanical systems in the laboratory.

But the high percentage of human error reported here calls into question claims that state-of-the-art design of BSL3, BSL3+ (augmented BSL3), and BSL4 labs will prevent the release of dangerous pathogens. How much lab-worker training might reduce human error and undetected or unreported laboratory acquired infections remains an open question. Given the many ways by which human error can occur, it is doubtful that Fouchier’s human-error-prevention measures can eliminate release of airborne-transmissible avian flu into the community through undetected or unreported lab infections.

Human-error incident data.

In its 2016 study for the NIH, “Risk and Benefit Analysis of Gain of Function Research,” Gryphon Scientific looked to the transportation, chemical, and nuclear sectors to define types of human error and their probabilities. As Gryphon summarized in its findings, the three types of human error are skill-based (errors involving motor skills involving little thought), rule-based (errors in following instructions or set procedures accidentally or purposely), and knowledge-based (errors stemming from a lack of knowledge or a wrong judgment call based on lack of experience).

Gryphon claimed that “no comprehensive Human Reliability Analysis (HRA) study has yet been completed for a biological laboratory… . This lack of data required finding suitable proxies for accidents in other fields.”

But mandatory incident reporting to FSAP and NIH actually does provide sufficient data to quantify human error in BSL3 biocontainment labs.

Federal Select Agent Program incident data.

FSAP incident data were collected from summary reports to Congress for the years 2009 through 2015.

Three of the seven FSAP incident categories involve skill-based errors: 1) needle sticks and other through the skin exposures from sharp objects, 2) dropped containers or spills/splashes of liquids containing pathogens, and 3) bites or scratches from infected animals. Some skill errors, such as spills and needle sticks could be reduced with simple fixes (see below).

The rule-based and knowledge-based incident categories are: 4) pathogens manipulated outside of a biosafety cabinet or other equipment designed to protect exposures to infectious aerosols; 5) potential exposures resulting from non-adherence to safety procedures or deviations from lab standard operating procedures, and 6) failure or problem with personal protective equipment -- a mix of skill, rule, or knowledge-based errors.

The seventh category is mechanical or equipment failure, or defective labware. Another category not mentioned in the FSAP reports is failure to properly inactivate pathogens before transferring them to a lower biosafety level lab for further research.

During the 2009-2015 time period, FSAP received a total of 749 incident reports from select-agent research facilities. Conservatively, 594 or 79.3 percent of those incidents involve human error. (Details may be found in the Supplementary Material.)

National Institutes of Health incident data.

Incident reports to the NIH Office of Science Policy cover the period from 2004 through 2017 and BSL3 and BSL4 facilities. They were obtained through a Freedom of Information Act request.

There were no reported incidents from BSL4 facilities. Reporting to NIH is required only for incidents involving pathogens that contain recombinant DNA. While it is highly likely there have been incidents in BSL4 facilities, they may not have involved pathogens with recombinant DNA and so would not show up in the reports to NIH.

The 128 incident reports provide extremely detailed descriptions. The reports are often several-dozen pages long so almost no questions remain about details.

Of the 128 incidents, 86 or 67.2 percent were due to human error. This percentage is in the same ballpark as the FSAP reports.

Some human errors are “one-off,” meaning they happened once and likely won’t happen again. One-off errors are difficult to anticipate, so it is unlikely that one can devise meaningful changes in standard operating procedures to prevent them. Here is one example of a one-off error, slightly modified from an incident report:

A researcher was exchanging two plastic 24-well plates in the tabletop Sorvall centrifuge. While closing the lid, it was caught on a centrifuge wrench which was accidentally placed into the path of the lid. The wrench jumped and knocked one of the removed 24-well plates onto the counter. The plate landed at approximately a 45-degree angle and lost approximately half its contents to the bench top.

For some errors, there are procedural changes that should reduce their frequency. For instance, needle sticks can occur from syringes with sharp metal needles when being used to transfer liquids from one small container to another. For injecting animals, sharp metal needles are needed; but for liquid transfers, blunt-plastic needles would suffice. Also, dropping items could sometimes be prevented using lab carts to transport items from place to place, rather than carrying them by hand.

Here are three comments from the aforementioned Fouchier publication.

• “Only authorized and experienced personnel that have received extensive training can access the facility.”
• “All personnel have been instructed and trained how to act in case of incidents.”
• “For animal handling, personnel always work in pairs to reduce the chance of human error.”

The first two bullets speak to standard training of lab workers who work with particularly dangerous pathogens. It is unclear whether the diligent training of lab workers he outlines would substantially reduce human error:

The entities reporting incidents to NIH mention similar diligent training; nonetheless, undetected or unreported laboratory acquired infections occur with high frequency in these laboratories. Furthermore, it is unclear whether other laboratories creating and researching airborne-transmissible diseases are so carefully designed and diligent in their training.

The two-person rule for animal handling is a good idea that is not typically mentioned in the detailed NIH incident reports. Animal bites and needle punctures brought about by unruly lab animals are not uncommon.


Release from high biocontainment through incomplete inactivation.

Beyond the aforementioned undetected or unreported laboratory-acquired infections lies another route by which pathogens can be released from high biosecure level labs—incomplete inactivation.

Inactivation is designed to destroy the pathogenicity of an infectious agent, while retaining its other characteristics for research in which live pathogens are not needed. Since there are reliable inactivation procedures, failure to inactivate is a human error.

Pathogens are inactivated for research that can be performed in lower BSL2 biocontainment, where it is much easier to carry out. Research in BSL3 and BSL4 laboratories is difficult, both because of restricted movement in the personal protective equipment that must be worn and because of restrictions in operating procedures that aim to minimize potential exposure to pathogens.

While incomplete inactivation does not usually directly cause a release into the community, researchers in BSL2 labs are at a much higher risk of infection, and their street clothes, hair, and skin can become contaminated. But incomplete inactivation is a route to potential release into the community.

The FSAP does not routinely collect data on incomplete inactivation, and it seems no one else does either. Thus, enough data to calculate probabilities for this type of incident are not available. But the Government Accountability Office (GAO) has weighed in on the issue. The GAO reports anecdotal evidence and some numbers on incomplete inactivation to support the contention that it is a serious issue. The office has identified 11 incidents, in addition to 10 incidents already identified by the FSAP. Notably, two of the incidents involved Ebola and Marburg viruses, which because of a lack of countermeasures (vaccines and antivirals) are researched at BSL4 facilities.

Among other things, the GAO report called attention to a well-publicized incident in which a Defense Department laboratory “inadvertently sent live Bacillus anthracis, the bacterium that causes anthrax, to almost 200 laboratories worldwide over the course of 12 years. The laboratory believed that the samples had been inactivated.” The report describes yet another well-publicized incident in China in which “two researchers conducting virus research were exposed to severe acute respiratory syndrome (SARS) coronavirus samples that were incompletely inactivated. The researchers subsequently transmitted SARS to others, leading to several infections and one death in 2004.”

The GAO identified three recent releases of Ebola and Marburg viruses from BSL4 to lower containment labs due to incomplete inactivation.

A fourth release in 2014 from the CDC labs occurred when “Scientists inadvertently switched samples designated for live Ebola virus studies with samples intended for studies with inactivated material. As a result, the samples with viable Ebola virus, instead of the samples with inactivated Ebola virus, were transferred out of a BSL-4 laboratory to a laboratory with a lower safety level for additional analysis. While no one contracted Ebola virus in this instance, the consequences could have been dire for the personnel involved as there are currently no approved treatments or vaccines for this virus.”


The CDC has issued a report on this mixup, and the steps they have taken to avoid this particular error in the future.

All these incidents confirm the role of incomplete inactivation that would lead to an increased likelihood of release into the community from a BSL2 lab. These are all human errors, some involving BSL4 pathogens. Along with the observation that other human errors are the cause of more than two-thirds of potential exposures in BSL3 labs, it is clear that state-of-the-art laboratory design will not prevent release into the community.

The probability of release into the community.

In an analysis circulated at the 2017 meeting for the Biological Weapons Convention, a conservative estimate shows that the probability is about 20 percent for a release of a mammalian-airborne-transmissible, highly pathogenic avian influenza virus into the community from at least one of 10 labs over a 10-year period of developing and researching this type of pathogen. This percentage was calculated from FSAP data for the years 2004 through 2010.

Analysis of the FOIA NIH data gives a much higher release probability—that is, a factor five to 10 times higher, based on a smaller number of incident reports.


While there is no obvious reason in the NIH data that would explain this high probability, exposures and latent (not-active) infections with M. tuberculosis was indicated in four incident reports. M. tuberculosis is not a select agent so incidents involving it would not necessarily be reported to the FSAP. Tuberculosis is highly contagious by the airborne route, so it might be easier to acquire a TB infection in the lab. Unfortunately, airborne TB infections might be a harbinger of what could occur in research on airborne-transmissible flu.

Facility-reported descriptions of the 11 relevant incidents are provided in the Supplementary Material (Appendix 2). Lab-acquired infections are often discovered some time after the incident occurred. Only for three were the causes confirmed to be human error. For the other eight, neither the infected lab workers nor facility officials knew how the infection occurred. While it is likely that human error was involved in many of these eight infections, their causes will never be known.

Likelihood that mammalian-airborne-transmissible, highly pathogenic avian influenza release could cause a deadly pandemic.

The avian flu virus H5N1 kills 60 percent of people who become infected from direct contact with infected birds. The mammalian-airborne-transmissible, highly pathogenic avian influenza created in the Fouchier and Kawaoka labs should be able to infect humans through the air, and the viruses could be deadly.

A release into the community of such a pathogen could seed a pandemic with a probability of perhaps 15 percent. This estimate is from an average of two very different approaches. One approach involves purely mathematical branching theory, where Harvard researcher Marc Lipsitch and coworkers provide a graph in which, conservatively, the probability that a pandemic is seeded from a single release is about 20 percent. In the second approach, where infection progress through the community from person to person is simulated, Bruno Kessler Foundation researcher Stefano Merler and coworkers found that there is a probability from five percent to 15 percent that a single release could seed a pandemic. How deadly and how transmissible such viruses are in humans is not known.


Dealing realistically with human errors in lab research. Human error will continue to play a major role in laboratory incidents, and undetected or unreported laboratory acquired infections and incomplete inactivation incidents will continue to occur. No matter how well facilities are designed to prevent release into communities, human error will dodge design.

For an already identified 14 labs creating or researching mammalian-airborne-transmissible, highly pathogenic avian influenza, the potential 16 percent probability of a laboratory release into the community over five years of research (a result found in a study now being prepared for publication) is already uncomfortably high. NIH incident reports indicate possibly much higher probabilities of a such a release -- thus, a greater likelihood of a pandemic. This does not take into the account a release from incomplete inactivation. Combining release probability with the not insignificant probability that an airborne-transmissible influenza virus could seed a pandemic, we have an alarming situation.

Those who support mammalian-airborne-transmissible, highly pathogenic avian influenza experiments either believe the probability of community release is infinitesimal or the benefits in preventing a pandemic are great enough to justify the risk. For this research, it would take extraordinary benefits and significant risk reduction via extraordinary biosafety measures to correct such a massive overbalance of highly uncertain benefits to too-likely risks.

Whatever probability number we are gambling with, it is clearly far too high a risk to human lives. There are experimental approaches that do not involve live mammalian-airborne-transmissible, highly pathogenic avian influenza which identify mutations involved in mammalian airborne transmission. These “safer experimental approaches are both more scientifically informative and more straightforward to translate into improved public health…” Asian bird flu virus research to develop live strains transmissible via aerosols among mammals (and perhaps some other potentially pandemic disease research as well), should for the present be restricted to special BSL4 laboratories or augmented BSL3 facilities where lab workers are not allowed to leave the facility until it is certain that they have not become infected.


It must be emphasized that the focus here is for only a very small subset of pathogen research. Most pathogen research should proceed unimpeded by unnecessary regulations.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 6:53 am

Bat Severe Acute Respiratory Syndrome-Like Coronavirus WIV1 Encodes an Extra Accessory Protein, ORFX, Involved in Modulation of the Host Immune Response
by Lei-Ping Zeng, Yu-Tao Gao, Xing-Yi Ge, Qian Zhang, Cheng Peng, Xing-Lou Yang, Bing Tan, Jing Chen, Aleksei A. Chmura, Peter Daszak, and Zheng-Li Shi
S. Perlman, Editor
University of Iowa
Copyright © 2016, American Society for Microbiology. All Rights Reserved.

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


There have been three publications, in 2015,30 2016 and 2017, describing the WIV gain of function research. The WIV, having learned both basic and traceless infectious-clone technology from joint research with a laboratory at the University of North Carolina (UNC) in 2015, initiated construction of novel chimeric coronaviruses without UNC immediately thereafter. WIV’s first publication on the use of basic infectious-clone technology to construct novel chimeric coronaviruses at WIV appeared in 2016.31 WIV’s first publication on the use of traceless, signature-free infectious-clone technology also appeared in 2016.32

-- Did the SARS-CoV-2 virus arise from a bat coronavirus research program in a Chinese laboratory? Very possibly, by Milton Leitenberg


ABSTRACT

Bats harbor severe acute respiratory syndrome (SARS)-like coronaviruses (SL-CoVs) from which the causative agent of the 2002-2003 SARS pandemic is thought to have originated. However, despite the fact that a large number of genetically diverse SL-CoV sequences have been detected in bats, only two strains (named WIV1 and WIV16) have been successfully cultured in vitro. These two strains differ from SARS-CoV only in containing an extra open reading frame (ORF) (named ORFX), between ORF6 and ORF7, which has no homology to any known protein sequences. In this study, we constructed a full-length cDNA clone of SL-CoV WIV1 (rWIV1), an ORFX deletion mutant (rWIV1-ΔX), and a green fluorescent protein (GFP)-expressing mutant (rWIV1-GFP-ΔX). Northern blotting and fluorescence microscopy indicate that ORFX was expressed during WIV1 infection. A virus infection assay showed that rWIV1-ΔX replicated as efficiently as rWIV1 in Vero E6, Calu-3, and HeLa-hACE2 cells. Further study showed that ORFX could inhibit interferon production and activate NF-κB. Our results demonstrate for the first time that the unique ORFX in the WIV1 strain is a functional gene involving modulation of the host immune response but is not essential for in vitro viral replication.

IMPORTANCE

Bats harbor genetically diverse SARS-like coronaviruses (SL-CoVs), and some of them have the potential for interspecies transmission. A unique open reading frame (ORFX) was identified in the genomes of two recently isolated bat SL-CoV strains (WIV1 and -16). It will therefore be critical to clarify whether and how this protein contributes to virulence during viral infection. Here we revealed that the unique ORFX is a functional gene that is involved in the modulation of the host immune response but is not essential for in vitro viral replication. Our results provide important information for further exploration of the ORFX function in the future. Moreover, the reverse genetics system we constructed will be helpful for study of the pathogenesis of this group of viruses and to develop therapeutics for future control of emerging SARS-like infections.

INTRODUCTION

Severe acute respiratory syndrome coronavirus (SARS-CoV) is a zoonotic pathogen that caused the 2002-2003 SARS pandemic, which originated in China (1). Since then, genetically diverse SARS-like coronaviruses (SL-CoVs) have been reported in bats in China, Europe, and Africa (2,–11), indicating a wide geographic distribution of this group of viruses. However, most bat SL-CoVs have been identified only by sequences and are not fully characterized due to the lack of cultured viruses. Thus, their potential for transmission to and likely pathogenesis in domestic animals and humans remain untested. WIV1 and WIV16 are two recently identified SL-CoV strains with high genomic similarity to human SARS-CoV. These two strains have been successfully cultured in vitro and have been shown to use the same molecule (angiotensin-converting enzyme [ACE2]) for cellular entry as SARS-CoV (2, 10). Recently, another bat SL-CoV strain, SHC014, has been demonstrated to use human ACE2 by the construction of an infectious cDNA clone (12). Furthermore, animal infection experiments indicated that SL-CoV WIV1 and SHC014 could replicate efficiently and caused low pathogenesis in ACE2 transgenic mice (12, 13). The fact that the native bat SL-CoVs could use human ACE2 without any mutations indicates a high risk of interspecies transmission for these and similar coronaviruses that may exist in natural reservoirs.

Coronaviruses have the largest genomes among RNA viruses. Their genomes consist of a positive, single-stranded RNA of around 30,000 nucleotides (nt), with two-thirds at the 5′ end encoding genome replication proteins (ORF1ab) and one-third at the 3′ end encoding structural proteins, including a spike glycoprotein (S), a small envelope protein (E), a membrane protein (M), and a nucleocapsid protein (N). Coronaviruses carry a set of open reading frames (ORFs) expressed from full-length mRNAs and subgenomic-length mRNAs (sgRNAs), which have a common 3′ end originating at distinct transcription regulatory sequences (TRS) and joined with a common leader sequence encoded at the 5′ end of genomic RNA (14). Currently, coronaviruses are divided into the genera Alphacoronavirus, Betacoronavirus, and Gammacoronavirus and the proposed genus Deltacoronavirus (15). SARS-CoV and SL-CoVs are grouped into the same coronavirus species, SARS-related coronavirus (SARSr-CoV), within the genus Betacoronavirus. Besides the family-conserved genes, SARSr-CoV possesses several accessory genes, including ORF3, ORF6, ORF7, ORF8, and ORF9, which are specific for this group of coronaviruses but not essential for in vitro viral replication (16,–18). Accessory genes in coronavirus genomes play important roles in regulating the host immune response (19). The SARS-CoV ORF3a, ORF3b, and ORF6 have been reported to inhibit the host interferon (IFN) response during virus infection and contribute to pathogenesis (20, 21). ORF3a and ORF7a activate NF-κB and upregulate interleukin-8 (IL-8) and CCL5 production (22, 23). Bat SL-CoVs display great genetic diversity and share overall nucleotide sequence identities of 88 to 97% with human SARS-CoV (2,–11). Bat SL-CoVs WIV1 and WIV16 are the closest relatives to human SARS-CoV discovered so far. These two viruses are identical in genomic structures except that WIV1 and -16 have an extra ORF (named ORFX) between ORF6 and ORF7 with no homology to any known protein sequences (2, 10).

In this study, we explored the function of ORFX in modulating the host immune response through the use of eukaryotic overexpression assays and recombinant viruses generated through reverse genetics techniques.

MATERIALS AND METHODS

Virus and cells.


The SL-CoV WIV1 strain (GenBank accession number KF367457) and other viruses were propagated as described previously (2). Sendai virus (SeV) strain Cantell (kindly provided by Hanzhong Wang) was propagated in 10-day-old embryonated chicken eggs at 37°C for 48 h (24). All experiments using live virus was conducted under biosafety level 2 (BSL2) conditions. HeLa cells stably expressing human ACE2 (HeLa-hACE2) were described previously (25). 293T, Vero E6, HeLa, and HeLa-hACE2 cells were grown and propagated in Dulbecco's modified Eagle's medium (GIBCO, Invitrogen) supplemented with 10% fetal bovine serum (Life Technologies). Calu-3 cells were grown and propagated in Dulbecco's modified Eagle's medium–nutrient mixture F-12 medium supplemented with 15% fetal bovine serum. Cells were grown at 37°C in a humidified atmosphere with 5% CO2.

Plasmids.

The coding region of ORFX was amplified by reverse transcription-PCR (RT-PCR) from viral RNA using the Superscript one-step RT-PCR kit (Invitrogen). The amplified gene was cloned into plasmid pCAGGS with a C-terminal hemagglutinin (HA) tag (pCAGGS-ORFX) for eukaryotic expression. Reporter plasmids used included pIFNκ-Luc (expressing firefly luciferase under the control of the IFN-β promoter), pNF-κB-Luc (expressing firefly luciferase under the control of the NF-κB promoter), and pRL-TK (expressing Renilla luciferase under the control of the herpes simplex virus thymidine kinase promoter), as well as an expression plasmid for influenza virus NS1, as described previously (24). Plasmids expressing subcellular organelle markers, including SecG1β-green fluorescent protein (GFP) (endoplasmic reticulum [ER] marker), B4Gal-Ti-red fluorescent protein (RFP) (Golgi apparatus marker), and Mito-yellow fluorescent protein (YFP) (mitochondrion marker), were kindly provided by Yanyi Wang of the Wuhan Institute of Virology.

Viral infection assays.

Vero E6, Calu-3, and HeLa-hACE2 cells were infected with viruses at a multiplicity of infection (MOI) of 1.0, 0.1, or 0.001 in 25-cm2 flasks with a 1-h adsorption period, followed by two washes with D-Hanks solution and culturing by adding 3 ml of medium. The viral supernatants were harvested, at 0, 2, 6, 12, 18, 24, 36, 48, and 72 h postinoculation, with 300 μl removed and 300 μl medium added back at each time point. The virus concentration was titrated by plaque assay in Vero E6 cells.

Vero E6 cells were infected by rWIV1-GFP-ΔX or mock infected. After 24 h, fluorescence micrographs was taken to check the expression of green fluorescent protein.

Cloning of WIV1 cDNAs.

The virus genome was divided into 8 continuous fragments (A to G) and amplified using specific primers (primer sequences are available upon request). Viral RNA was extracted from the supernatant of WIV1-infected cultures and reverse transcribed with Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega) and random hexamer deoxynucleotide primers. The cDNA was denatured for 5 min at 95°C and amplified by PCR with KOD DNA polymerase (Toyobo) for 20 cycles of 95°C for 30 s, 60°C for 30 s with a 0.5°C decrease per cycle, and 68°C for 5 min, 15 cycles of 95°C for 30 s, 50°C for 30 s, and 68°C for 5 min, and a final extension at 68°C for 10 min. The amplicons were cloned into pGEM-T Easy (Promega). Besides three natural BglI sites, several BglI sites were introduced by synonymous mutations in the PCR process to make all contiguous cDNA fragments capable of unidirectional ligation. SacII and AscI sites were introduced into the 5′ terminus of fragment A and the 3′ terminus of fragment G, respectively. A poly(A) sequence (25 nt) was added to the 3′ terminus of fragment G. At least three colonies of each cDNA clone were sequenced, and the one identical to or with some synonymous mutations to the reported sequence was selected for assembly.

To ablate a natural BglI site at position 1575, primers FA, F-c1575a, R-c1575a, and RA were used for overlap extension PCR (OE-PCR) to introduce the synonymous mutation C1575A (primer sequences are available upon request). Based on previous in vitro transcription tests, the synonymous mutation T27527C was also introduced to interrupt a potential T7 termination site via OE-PCR.

Strategy for modifying pBeloBAC11.

The cytomegalovirus (CMV) promoter was amplified from pcDNA3.1(+) (Thermo Fisher Scientific) with forward primer 5′-TGAGGATCCCGTTGACATTGATTATTGACTAG-3′ and reverse primer 5′-CCTGACTGCAGGTCGACTGCCGCGGAGCTCTGCTTATATAGACC-3′. Hepatitis delta virus (HDV) ribozyme was synthesized as described previously (26), and amplified with forward primer 5′-CAGTCGACCTGCAGTCAGGCGCGCCGGGTCGGCATGGCATCTCC-3′ and reverse primer 5′-CTAGAAGGCACAGCTCCCTTAGCCATCCGAGTGG-3′. The bovine growth hormone (BGH) transcription terminal signal was amplified from pcDNA3.1(+) with forward primer 5′-GGATGGCTAAGGGAGCTGTGCCTTCTAGTTGCCAGC-3′ and reverse primer 5′-TGAAAGCTTCCATAGAGCCCACCGCATCC-3′. The three PCR products then were ligated using OE-PCR, with BamHI and HindIII sites flanking the amplicon and SacII and AscI sites between the CMV promoter and HDV ribozyme. The amplicon was then inserted into pBeloBAC11 (New England BioLabs) between BamHI and HindIII sites. The construct was designated pBAC-CMV.

Construction of infectious bacterial artificial chromosome (BAC) clones of WIV1.

Subclone A and subclone G were first digested with SacII and AscI (New England BioLabs), respectively, followed by treatment with calf intestinal alkaline phosphatase (CIAP) (TaKaRa), chloroform extraction, and isopropanol precipitation, and then restricted with BglI (TaKaRa). Subclones B to F were digested with BglI. pBAC-CMV was digested with SacII and AscI. All digestion products were then separated using 1% agarose gels, excised, and purified by using a gel extraction kit (Omega). Digested fragments A to G and pBAC-CMV were ligated overnight at 4°C, transformed into DH10B competent cells, and plated on Chl+ LB culture. Ten clones were screened by restriction fragment length polymorphism (RFLP) analysis with NcoI, StuI, or HindIII. The correct clone was named pBAC-CMV-rWIV1 (Fig. 1).

Image
FIG 1. Strategy for construction of an infectious WIV1 BAC clone. (A) Genomic structure of WIV1. (B) The mutations are indicated under the stars. C1575A was used to ablate a natural BglI site at nucleotide 1571 (▽), and T27527C was used to disrupt a potential T7 stop site. The others were for introducing BglI sites (▼). (C) The WIV1 genome was split into eight contiguous cDNAs (A to G): A, nt 1 to 4387; B, nt 4388 to 8032; C1, nt 8033 to 10561; C2, nt 10562 to 12079; D, nt 12080 to 17017; E, nt 17018 to 22468; F, nt 22469 to 27352; G, nt 27353 to 30309. Unique BglI sites were introduced into the fragments by synonymous mutations to make these fragments capable of unidirectional ligation along with native BglI sites in the genome. The original nucleotides are shown above the flanking sequences of corresponding fragments. A poly(A) sequence was added to the 3′ terminus of fragment G. A CMV promoter, HDV ribozyme, and BGH transcriptional terminal signal were inserted into pBeloBAC11 between BamHI and HindIII sites. SacII and AscI sites were introduced between the CMV promoter and ribozyme. Fragments A to G were inserted into the pBAC-CMV plasmid in a single step.

Construction of WIV1 mutants.

To delete ORFX, the fragment F was PCR amplified with primers FF (5′-ACCTGTGCCCTTTTGGCGAGGTTTTTAATGCTACTAC-3′) and RFox (5′-GCCTCTAGGGCTCAAGGATAATCTATCTCCATAGG-3′). Fragment G was PCR amplified with FGox (5′-GCCCTAGAGGCAACGAACATGAAAATTATTCTCTTCC-3′) and RG (5′-ACTGGCGCGCCTTTTTTTTTTTTTTTTTTTTTTTTTGTCATTCTCCTGAGAAGC-3′). This new fragment was named Gox. These two products were then cloned into pGEM-T Easy. The two fragments were inserted into the BAC along with the other fragments as described above. The rescued mutant was named as rWIV1-ΔX. To place GFP into the open reading frame of ORFX, the F fragment was amplified with primers FF and RFoeGFP (5′-GCTCACCATAGTGGTTCGTTTATCAAGGATAATCTATCTCC-3′). The GFP gene was amplified with primers 5′-CCTTGATAAACGAACCACTATGGTGAGCAAGGGCGAGGAGC-3′ and 5′-TGCCTCTAGGGCTTACTTGTACAGCTCGTCCATGCC-3′. The two PCR products were ligated by OE-PCR, and the product was inserted into pGEM-T Easy. The rescued mutant was named rWIV1-GFP-ΔX.

Transfection of infectious WIV1 BAC clones.

Vero E6 cells were seeded in a 6-well plate a day in advance, and then one well was transfected with 6 μg infectious BAC plasmids constructed as described above with Lipofectamine LTX and Plus reagent (Life Technologies). Virus progeny was plaque purified once. One clone was passaged once in Vero E6 cells for 72 h and used to generate a stock for future use.

RFLP.

RNAs extracted from wild-type and recombinant viruses were reverse transcribed with random hexamer primers. RT-PCR was used to generate five amplicons containing the five mutations designed in the strategy. These amplicons included a 1,124-bp amplicon (nucleotide positions 1312 to 2435) spanning a naturally occurring BglI site at nucleotide 1571 that had been ablated in recombinant viruses, a 1,438-bp amplicon spanning the B/C1 junction (nucleotide positions 7560 to 8997), a 1,437-bp amplicon spanning the C1/C2 junction (nucleotide positions 10196 to 11632), a 1,437-bp amplicon spanning the D/E junction (nucleotide positions 16793 to 18229), and a 1,438-bp amplicon spanning the E/F junction (nucleotide positions 21908 to 23345) (these amplicons correspond to fragments F1 to F5 in Fig. 1). The first amplicon of wild-type WIV1 (wtWIV1) that contains nucleotide 1571 can be cleaved by BglI, but the other four amplicons cannot. In contrast, the five amplicons of recombinant viruses are different from those of wild-type virus in the capability of being cut by BglI.

Northern blot analysis.

The N gene was amplified with primers WIV1-NF (5′-ATGTCTGATAATGGACCCCA-3′) and WIV1-3R (5′-GTCATTCTCCTGAGAAGCTA-3′) and used as a template for probe preparation according to the description in the DIG-High Prime DNA labeling and detection starter kit II (Roche). Vero E6 cells were infected with wild-type and recombinant viruses at an MOI of 1.0. At 24 h postinfection, intracellular RNA was isolated using TRIzol reagent (Ambion). RNA (20 μg) was precipitated, treated with 17 μl sample buffer (50% formamide, 2.2 M formaldehyde [37%], 1× morpholinepropanesulfonic acid [MOPS]) at 65°C for 10 min, supplemented with 3 μl 10× dye solution (50% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanole FF), and then separated in a denaturing 0.8% agarose–2.2 M formaldehyde gel at 28 V for ∼17 h. The RNA was hydrolyzed with 0.05 M NaOH for 40 min, transferred to a Hybond-N+ membrane (GE Healthcare) for ∼18 h, and then cross-linked to the membrane using UV light. The membrane was prehybridized, probed with a digoxigenin (DIG)-labeled probe for the N gene, and washed, and detection was performed according to the instructions for the DIG-High Prime DNA labeling and detection starter kit II (Roche).

RT-PCR of leader-containing transcripts.

Intracellular RNA was isolated from wtWIV1. A forward primer (Leader-F) located in the leader sequence, along with various reverse primers located in several ORFs, was used for amplifying leader-containing sequences (primer sequences are available upon request). Leader-containing amplicons were sequenced with the corresponding reverse primers.

ORFX subcellular location.

HeLa cells were transfected with an ORFX-expressing plasmid and cotransfected with organelle markers expressing plasmid SecG1β-GFP, B4Gal-Ti-RFP, or Mito-YFP. After 24 h, the cells were fixed and stained with a mouse anti-HA IgG (Promoter). A Cy3-conjugated goat anti-mouse IgG (Promoter) was used for secondary detection in cells expressing ER or mitochondrial markers. A fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Promoter) was used for secondary detection in cells expressing the Golgi marker. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). Staining patterns were examined with an Olympus Fluoview upright confocal microscope (Olympus).

Luciferase assays and quantitative PCR.

For the ORFX-mediated IFN promoter assay, 293T cells were seeded in 12-well plates and cotransfected with empty vector plasmid pCAGGS, plasmid pCAGGS-NS1, or increasing amounts (100, 200, 400, 600, and 800 ng) of pCAGGS-ORFX with the indicated reporter plasmids. At 24 h posttransfection, cells were infected with Sendai virus (SeV) (100 hemagglutinin units [HAU]/ml) for 12 h to induce IFN production or were treated with tumor necrosis factor alpha (TNF-α) for 1 h to activate NF-κB. Cell lysates were prepared, and luciferase activity was measured using dual-luciferase assay kits (Promega) according to the manufacturer's instructions.

293T cells were transfected with empty vector, NS1-expressing plasmid, or increasing amounts (100, 300, and 600 ng) of ORFX-expressing plasmid. After 24 h, the cells were infected with SeV (100 HAU/ml). At 12 h postinfection, the cells were lysed. The mRNA was extracted and reverse transcribed with PrimeScript RT master mix (TaKaRa). The expression level of IFN-β mRNA was determined by quantitative PCR using SYBR Premix Ex Taq II (TaKaRa). The GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA was quantified as an inner control. 293T cells were transfected as described above. After 24 h, the cells were treated with TNF-α for 6 h, and the cell RNA was extracted and used for quantification of the expression of IL-8 mRNA. All experiments were performed in triplicate and repeated at least three times. All primer sequences used in the quantitative PCRs are available upon request.

IRF3 translocation assay.

293T cells were transfected with empty vector, NS1, or ORFX-expressing plasmid. After 24 h, IFN regulatory factor 3 (IRF3) nuclear translocation was induced by infecting the cells with SeV for 8 h. The cells were fixed and stained with a rabbit anti-IRF3 polyclonal IgG (Proteintech) and a mouse anti-HA IgG (Promoter). An Alexa Fluor 488-conjugated donkey anti-rabbit IgG (Yeasen) and an Alexa Fluor 555-conjugated donkey anti-mouse IgG (Beyotime) were used to detect IRF3 and ORFX, respectively. The cells transfected with empty vector were stained with a rabbit anti-IRF3 polyclonal IgG and a goat anti-SeV IgG (kindly provided by Lin-Fa Wang, Duke-NUS Graduate Medical School, Singapore) as an indication of infection efficiency. An Alexa Fluor 488-conjugated donkey anti-rabbit IgG and a Cy3-conjugated donkey anti-goat IgG (Promoter) were used to detect IRF3 and SeV, respectively. Nuclei were stained with DAPI.

Quantification of mRNA expression of cytokines in infected Calu-3 cells.

Calu-3 cells grown in 24-well plates were mock infected or infected with rWIV1 or rWIV1-ΔX at an MOI of 5 or with SeV (100 HAU/ml). The cells were lysed at 4, 12, 24, and 30 h postinfection. The mRNA expression levels of IFN-β, IL-6, IL-8, and TNF-α were quantified by quantitative PCRs. The expression of GAPDH mRNA was measured as an internal control. All primer sequences used in the quantitative PCRs are available upon request. The experiment was performed twice.

IFN-β sensitivity assay.

Vero E6 cells were seeded a day in advance. The cells were pretreated with 10, 100, or 1,000 U/ml IFN-β (PBL, Piscataway, NJ) for 24 h, infected with wtWIV1, rWIV1, and rWIV1-ΔX at an MOI of 0.1 PFU/cell, and posttreated with the same amount of IFN-β as used previously. At 24 h postinfection, the viral replication was analyzed by plaque assay. The experiment was performed in triplicate.

Statistics.

The statistical significance of the obtained data was analyzed using a Student t test in GraphPad Prism (GraphPad Software, San Diego, CA). A P value of <0.05 was considered statistically significant. Data are presented as the means ± standard errors of the means (SEM).

RESULTS

Strategy for construction of an infectious WIV1 BAC.


Originally, the genome was split into seven contiguous cDNAs (A to G) (Fig. 1A and ​andC).C). Due to plasmid instability, fragment C was separated into two segments (C1 and C2). Besides three naturally occurring BglI sites (GCCNNNN↓NGGC), four BglI sites were successfully introduced by synonymous mutations in the genome (Fig. 1B). Different asymmetric 3-nt overhangs at the junctions of each two contiguous fragments were created by these BglI sites. The eight fragments were then linked in one direction. A SacII site was added to the 5′ terminus of fragment A. A poly(A) sequence (25 nt) and an AscI site were added to the 3′ terminus of fragment G. A naturally occurring BglI site at nucleotide 1571 was removed by the synonymous mutation C1575A (Fig. 1B). Other unexpected synonymous mutations also occurred, including T1422C, T12984C, T14213C, T17130C, C17934T, and T26068G.

The plasmid pBAC-CMV was constructed by inserting the cytomegalovirus (CMV) promoter, hepatitis delta virus (HDV) ribozyme, and bovine growth hormone (BGH) transcription terminal signal sequences into pBeloBAC11, along with the introduction of the SacII and AscI sites between the CMV promoter and HDV ribozyme (Fig. 1C). The eight genomic fragments were inserted into pBAC-CMV in one step. Recombinant viruses could be rescued by direct transfection with the BAC constructs.

Rescue of recombinant viruses.

To rescue recombinant WIV1 (rWIV1), fragments A and G were digested with SacII and AscI, respectively. Following calf intestinal alkaline phosphatase (CIAP) dephosphorylation, the two fragments, along with fragments B to F, were digested using BglI and inserted into pBAC-CMV between SacII and AscI sites in one step. The constructed clone (pBAC-CMV-rWIV1) was transfected into Vero E6 cells. A cytopathic effect was observed at 72 h posttransfection. The one ablated natural BglI site and four introduced BglI sites in the rescued viral genome were confirmed by restriction fragment length polymorphism (RFLP) analysis with BglI digestion (Fig. 2A). Using this method, we also rescued an ORFX deletion mutant virus (rWIV1-ΔX) (Fig. 2B, lane 2) and a mutant with a GFP sequence placed in the coding region of ORFX (rWIV1-GFP-ΔX) (Fig. 3A).

Image
FIG 2. Recovery and characterization of recombinant viruses. (A) Restriction fragment length polymorphism. Amplicons flanking five mutated sites of wild-type and recombinant viruses were digested by BglI. The first amplicon (F1) of wild-type virus can be digested by BglI, and its other four amplicons (F2 to F5) cannot be. In contrast, for amplicons of rWIV1, the first amplicon (F1) cannot be digested by BglI and its other four amplicons (F2 to F5) can be. Lane M, DL2000 DNA ladder (TaKaRa). (B) Detection of viral genomic transcription and replication by Northern blotting. Vero E6 cells were infected with wild-type or recombinant viruses, and intracellular RNA was extracted for Northern blot analysis. Lane 1, wtWIV1; lane 2, rWIV1-ΔX; lane 3, rWIV1; lane 4, uninfected control. (C) Growth kinetics of wild-type and recombinant viruses. Vero E6 cells were infected with wtWIV1 (■), rWIV1 (♢), or rWIV1-ΔX (▲) at an MOI of 1.0 or 0.1 PFU/cell. Cell supernatants were taken at the indicated time points postinfection, and virus titers were determined by plaque assay in Vero E6 cells.

Image
FIG 3. Expression and subcellular location of ORFX protein. (A) The open reading frame of ORFX was replaced by the GFP sequence, and the recombinant virus was rescued. Vero E6 cells were infected with the recombinant virus or mock infected. Green fluorescence was visualized at 24 h postinfection. (B) ORFX protein with an HA tag at the C terminus was expressed in HeLa cells, along with SecG1β-GFP (ER marker), Mito-YFP (mitochondria marker), or B4Gal-Ti-RFP (Golgi marker). The cells were fixed after 24 h and stained with a mouse anti-HA IgG. A Cy3-conjugated goat anti-mouse IgG was used for secondary detection in cells expressing an ER or mitochondrial marker. An FITC-conjugated goat anti-mouse IgG was used for secondary detection in cells expressing a Golgi marker. ORFX protein showed a cytoplasmic distribution and colocalized with the ER maker SecG1β.

ORFX is a functional gene not essential for virus replication.

The one-step growth curves for the two rescued recombinant viruses (rWIV1-ΔX and rWIV1) and wild-type WIV1 (wtWIV1) determined by plaque assay showed that rWIV1-ΔX and rWIV1 both replicated to titers close to those of wild-type virus (Fig. 2C). The expected set of appropriately sized 10 sgRNAs, including sgRNA7 (ORFX), were observed in Northern blot analysis in cells infected with wtWIV1 and rWIV1 (Fig. 2B, lanes 1 and 3). As expected, sgRNA7 was not observed in rWIV1-ΔX infected cells (Fig. 2B, lane 2). Analysis of leader-containing sequences indicated that all 10 sgRNAs in wtWIV1 share an identical core sequence, ACGAAC (Table 1), which further confirmed that ORFX is expressed as sgRNA7. The fact that GFP was expressed in rWIV1-GFP-ΔX-infected cells further confirmed that the open reading frame of ORFX could be expressed (Fig. 3A). Subcellular location analyses showed that the ORFX protein colocalized with the ER marker but not with the Golgi and mitochondrial markers (Fig. 3B).

TABLE 1: Leader-containing sequences of sgRNAs

sgRNA / ORF(s) / Leader-containing sequencea / Consensus sequence positions


1 / 1a/b / GTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT / 67–72
2 / S / GTAGATCTGTTCTCTAAACGAACATGAAATTGTTA / 21486–21491
3 / 3a/b / GTAGATCTGTTCTCTAAACGAACTTATGGATTTGT / 25263–25268
4 / E / GTAGATCTGTTCTCTAAACGAACTTATGTACTCAT / 26112–26117
5 / M / GTAGATCTGTTCTCTAAACGAACTAACTATTATTA / 26351–26356
6 / 6 / GTAGATCTGTTCTCTAAACGAACGCTTTCTTATTA / 26916–26921
7 / X / GTAGATCTGTTCTCTAAACGAACCACTATGTTACT / 27272–27277
8 / 7a/b / GTAGATCTGTTCTCTAAACGAACATGAAAATTATT / 27794–27799
9 / 8 / GTAGATCTGTTCTCTAAACGAACATGAAACTTCTC / 28300–28305
10 / N / GTAGATCTGTTCTCTAAACGAACAAACTAAAATGT / 28672–28677
aThe consensus sequence is in bold. Underlining indicates the initiation codon.


ORFX protein inhibits production of IFN-β.

To determine whether ORFX inhibits the induction of IFN, 293T cells were transfected with plasmids pIFNβ-Luc and pRL-TK and a plasmid expressing ORFX, influenza virus strain PR8 NS1 (positive control), or empty vector (negative control). As expected, SeV activated IFN production in cells transfected with empty vector. The positive control, influenza virus NS1 protein dramatically inhibited the expression from the IFN promoter. ORFX protein exhibited an inhibition effect, but the effect decreased when more ORFX protein was expressed (Fig. 4A). Similar results were observed for IFN-β mRNA quantification (Fig. 4B and ​andCC).

Image
FIG 4. ORFX protein inhibits the production of type I interferon. (A and B) 293T cells seeded in 12-well plates were transfected with 100 ng pIFN-β-Luc, 5 ng pRL-TK, empty vector, an influenza A NS1-expressing plasmid, or increasing doses (100, 200, 400, 600, and 800 ng) of an ORFX-expressing plasmid. Empty vector was added appropriately to ensure that cells in each well were transfected with the same amount of plasmids. The cells were infected with Sendai virus (100 hemagglutinating units/ml) at 24 h posttransfection. Samples were collected at 12 h postinfection, followed by dual-luciferase assay. The results were expressed as the firefly luciferase value normalized to that of Renilla luciferase. The relative expression of IFN-β mRNA was determined by quantitative RT-PCR and normalized to the expression level of GAPDH mRNA. (C) The expression of the NS1 and ORFX proteins was analyzed by Western blotting with an antibody against HA tag. The experiments were replicated three times. (D and E) For the IRF3 translocation assay, 293T cells were transfected with empty vector-, NS1-, or ORFX-expressing plasmid. After 24 h, the cells were infected with Sendai virus to induce IRF3 nuclear translocation. The cells were fixed at 8 h postinfection and stained with anti-HA IgG. A goat anti-Sendai virus polyclonal IgG was used to stain the cells transfected with empty vector. A rabbit anti-IRF3 polyclonal IgG was used to label IRF3. The white arrow indicates IRF3 nuclear translocation. The relative IRF3 translocation ratios were calculated for each group by counting the number of IRF3 nuclear translocation cells (randomly selected from at least 4 fields) and dividing by the total number of infected or transfected cells. The IRF3 nuclear translocation efficiency of each group was expressed as the percentage of their relative IRF3 translocation ratios to that of the control (cells transfected with empty vector). (F) Calu-3 cells were mock infected or infected with rWIV1 or rWIV1-ΔX (MOI of 5) or SeV (100 HAU/ml). At 4, 12, 24, and 30 h postinfection, the cell RNA was extracted and used for quantitative RT-PCR of the expression level of IFN-β mRNA. The experiment was performed in triplicate and replicated twice. (G) Vero E6 cells were pretreated with indicated amount of IFN-β, infected with wtWIV1, rWIV1, or rWIV1-ΔX at an MOI of 0.1 PFU/cell, and posttreated with IFN-β. Viral replication was analyzed at 24 h postinfection by plaque assay. The experiment was performed in triplicate and replicated twice. The differences between selected groups were significant, with P values of less than 0.05, as follows: 0.0049 (*; bars 4 and 6 in panel A), 0.0008 (**; bars 6 and 7 in panel A), 0.0072 (*; bars 4 and 6 in panel B), 0.018 (*; bars for rWIV1 and rWIV1-ΔX in panel F), and <0.0001 (*** in panel G).

An IRF3 nuclear translocation assay was performed to see whether ORFX protein inhibits IFN production through inhibiting this process. 293T cells were transfected with an empty vector-, NS1-, or ORFX-expressing plasmid. After 24 h, IRF3 nuclear translocation was induced by infection with SeV for 8 h. The relative IRF3 translocation ratios were calculated for each group by counting the number of the IRF3 nuclear translocation cells (randomly selected from at least 4 fields) divided by the number of total infected or transfected cells. The IRF3 nuclear translocation efficiency of each group was expressed as the percentage of their relative IRF3 translocation ratios to that of the control (cells transfected with empty vector). As expected, NS1 strongly inhibited translocation of IRF3, while ORFX protein also showed inhibition of IRF3 translocation but less efficiently (Fig. 4D and ​andEE).

To further investigate the IFN inhibition activity of ORFX, the deletion mutant and wild-type recombinant virus were used to infect Calu-3 cells at an MOI of 5. Mock-infected cells were used as negative control. Calu-3 cells infected with SeV were used as positive control. Samples were collected at 4, 12, 24, and 30 h postinfection. The relative expression of IFN-β mRNA was determined by quantitative PCR and normalized to the expression of GAPDH mRNA. Compared to SeV, WIV1 recombinants induced low levels of IFN-β mRNA in Calu-3 cells (Fig. 4F). The ORFX deletion mutant induced a significantly higher level of IFN-β mRNA than wild-type recombinant virus in infected cells at 12 h postinfection, but there were no significant differences at 24 and 30 h postinfection (Fig. 4F). These results indicate that ORFX protein may play a role in antagonizing IFN only at early times during WIV1 infection.

An ORFX deletion mutant shows increased sensitivity to IFN-β.

To further investigate the effect of ORFX on the viral sensitivity of IFN, we tested the replication efficiencies of wtWIV1, rWIV1, and rWIV1-ΔX in Vero E6 cells which were pretreated and posttreated with IFN-β. The replication of rWIV1-ΔX was inhibited and reduced by ∼0.5 log compared to that of wtWIV1 and rWIV1 at concentrations of 10 and 100 U/ml IFN-β (Fig. 4G), whereas at a higher IFN-β concentration (1,000 U/ml), the rWIV1-ΔX titers did not show an obvious decrease compared to those of wild-type virus. We expected that the ORFX deletion mutant would replicate less efficiently than the wild-type virus in IFN-competent cells. However, we did not find a significant difference when we grew the two viruses in Calu-3 and HeLa-hACE2 cells, even at a very low MOI of 0.001 (Fig. 5).

Image
FIG 5. Comparison of viral replication efficiencies of rWIV1-ΔX and rWIV1 in IFN-competent cells. Calu-3 (A) and HeLa-hACE2 (B) cells were infected with rWIV1 or rWIV1-ΔX at an MOI of 0.001. Samples were collected at 0, 12, 24, 36, 48, 72, 96, and 120 h postinfection. The viral titers were measured by plaque assay.

ORFX protein activates NF-κB.

NF-κB plays an important role in regulating the immune response to viral infection and is also a key factor frequently targeted by viruses for taking over the host cell (27). Several proteins (Nsp1, N, and 3a) encoded by SARS-CoV have activities in both IFN antagonism and NF-κB activation (28). In this study, we also tested whether ORFX protein could activate NF-κB. 293T cells were transfected with pNF-κB-Luc, pRL-TK, empty vector, NS1, or increasing amounts (200, 400, and 600 ng) of ORFX expressing plasmid. After 24 h, the cells were mock treated or treated with TNF-α for 6 h, and luciferase activity was determined. ORFX protein obviously activated NF-κB, no matter whether the cells were treated with TNF-α or not (Fig. 6A), whereas IL-8 was upregulated only when the cells were treated with TNF-α (Fig. 6B). However, no significant difference was observed for IL-6 and IL-8 transcription levels between the rWIV1-ΔX- and rWIV1-infected Calu-3 cells (Fig. 6C and ​andD).D). A significant difference was observed only for the induction of TNF-α mRNA at the late time of virus infection, when the ORFX deletion mutant induced less TNF-α mRNA (Fig. 6E).

Image
FIG 6. ORFX protein activates NF-κB. 293T cells were transfected with 100 ng pNF-κB-Luc, 10 ng pRL-TK, empty vector, an NS1-expressing plasmid, or increasing amounts (200, 400, and 600 ng) of an ORFX-expressing plasmid. After 24 h, the cells were treated with TNF-α. (A) Dual-luciferase activity was determined after 6 h. The results were expressed as the firefly luciferase activity normalized to that of Renilla luciferase. (B) The relative expression of IL-8 mRNA was quantified through quantitative RT-PCR and normalized to that of GAPDH mRNA. Differences between selected groups were significant, with P value less than 0.05, as follows: <0.0001 (***; bars 1 and 3 in panel A), 0.0339 (*; bars 4 and 7 in panel A), and 0.0002 (***; bars 4 and 6 in panel B). n.s., not significant. The experiments were performed three times. (C to E) The RNA extracted from Calu-3 cells for Fig. 4 was used for quantification of the expression of IL-6 (C), IL-8 (D), and TNF-α (E) mRNAs.

DISCUSSION

In this study, we have developed a fast and cost-effective method for reverse genetics of coronaviruses by combining two approaches developed by others (29, 30). Our method allows the genomes of coronaviruses to be split into multiple fragments and inserted into a BAC plasmid with a single step. Recombinant viruses can then be efficiently rescued by direct transfection of the BAC constructs. As the genomes can be divided into multiple short fragments, mutations can be introduced into individual fragments easily (31). Using this method, we successfully rescued three recombinant viruses derived from SL-CoV WIV1 (rWIV1, rWIV1-ΔX, and rWIV1-GFP-ΔX). The recombinant rWIV1 and rWIV1-ΔX replicated to titers close to those of wtWIV1 in Vero E6 cells (Fig. 2C), suggesting that the deletion of ORFX did not affect WIV1 replication in vitro. Northern blotting and fluorescence microscopy further confirmed that ORFX is transcribed as sgRNA7 and translated in virus-infected cells. These results demonstrated that the unique ORFX in SL-CoV WIV1 is a functional gene but is not essential for virus replication. We propose that the ORFX sgRNA is the template for the translation of a novel 11-kDa accessory protein of WIV1, bringing the total number of group-specific accessory proteins to ten.

In previous studies, it has been proved that SARS-CoV group-specific accessory genes ORF3b and ORF6 inhibit host IFN production and/or signaling during virus infection and contribute to viral pathogenesis (20). It is interesting to know whether the ORFX has a similar function in antagonizing IFN. In this study, ORFX protein showed an inhibitory effect on IFN production, but the effect decreased when more ORFX protein was expressed (Fig. 4A and ​andB).B). Moreover, the ORFX deletion mutant had a significantly lower inhibitory effect on IFN production than wild-type recombinant virus in infected Calu-3 cells, but only at an early time after infection (Fig. 4F). Furthermore, the IFN sensitivity assay indicated that the ORFX deletion mutant was more sensitive to IFN-β (Fig. 4G), suggesting that ORFX protein may participate in subverting the antiviral state stimulated by IFN-β. All these results suggested that ORFX participates in the modulation of the IFN response. Previous studies showed that SARS-CoV ORF3a and ORF7a activate NF-κB and upregulate IL-8 and CCL5 production (22, 23). In our study, we also found through a dual-luciferase assay that overexpressed ORFX can activate NF-κB (Fig. 6A). Furthermore, the level of TNF-α mRNA induced by wild-type recombinant virus was significantly higher than that induced by the ORFX deletion mutant, but only at the late stage of infection (Fig. 6E). These results indicated that ORFX also participates in activation of NF-κB. We noted that the IFN inhibition activity of ORFX was not dose dependent and decreased when there was more ORFX expression. One possible hypothesis is that ORFX inhibits IFN only at the early stage of infection. At the late stage, it activates NF-κB, which in turn stimulate IFN expression, and this leads to the attenuation of its IFN antagonist activity.

Coronavirus was previously shown to induce the unfolded-protein response (UPR) and ER stress in infected cell culture (32). Normally, ER is an active organelle for protein folding and modification. Loss of protein folding homeostasis would cause ER stress and induce the UPR, leading to the activation of three ER stress transducers. These transducers work in concert to attenuate translation and improve ER folding capacity to restore ER homeostasis (33). In this process, NF-κB is activated, and apoptosis will be induced if ER stress is prolonged (32, 33). In this study, we observed that the overexpression of ORFX protein led to cell death and the decrease of Renilla values (data not shown). This may imply that ORFX has a cytotoxic effect and an influence on overall protein translation. We also found that ORFX colocalizes with an ER marker. We hypothesize that ORFX may induce the UPR and cause ER stress which would activate NF-κB and induce apoptosis, promoting viral release at the late stage of infection.

It should be noted that the IFN and NF-κB detection systems used in this study were derived from and used in human cells. Since the innate immune system of bats is special and probably deficient in some aspects compared to the human system (34), it will be interesting to conduct the same studies in bat cells to determine whether ORFX protein has the same profiles as those observed in the human cell system. The development of different cell lines from the Rhinolophus bat, which is the reservoir host of SL-CoV, will facilitate this research in the future.

ACKNOWLEDGMENTS

We thank Hanzhong Wang, Zhenhua Zheng, Xianliang Ke, and Jin Meng (Research Group of Zoonotic Diseases, Wuhan Institute of Virology, CAS, China) for help and discussion, Yanyi Wang (Research Group of Molecular Immunology, Wuhan Institute of Virology, CAS, China) for kindly providing plasmids expressing cellular organelle markers (SecG1β-GFP, B4Gal-Ti-RFP, and Mito-YFP), Lin-Fa Wang (Duke-NUS Graduate Medical School, Singapore) for kindly providing a goat anti-SeV IgG, and Cecilia Waruhiu for language help.

This work was jointly funded by the National Natural Science Foundation of China (81290341, 31321001, and 81401672) and the National Institutes of Health (NIAID R01AI110964).


REFERENCES

1. Peiris JSM, Lai ST, Poon LLM, Guan Y, Yam LYC, Lim W, Nicholls J, Yee WKS, Yan WW, Cheung MT, Cheng VCC, Chan KH, Tsang DNC, Yung RWH, Ng TK, Yuen KY. 2003. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 361:1319–1325. doi:10.1016/S0140-6736(03)13077-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
2. Ge XY, Li JL, Yang XL, Chmura AA, Zhu G, Epstein JH, Mazet JK, Hu B, Zhang W, Peng C, Zhang YJ, Luo CM, Tan B, Wang N, Zhu Y, Crameri G, Zhang SY, Wang LF, Daszak P, Shi ZL. 2013. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature 503:535–538. doi:10.1038/nature12711. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
3. Yuan J, Hon CC, Li Y, Wang D, Xu G, Zhang H, Zhou P, Poon LL, Lam TT, Leung FC, Shi Z. 2010. Intraspecies diversity of SARS-like coronaviruses in Rhinolophus sinicus and its implications for the origin of SARS coronaviruses in humans. J Gen Virol 91:1058–1062. doi:10.1099/vir.0.016378-0. [PubMed] [CrossRef] [Google Scholar]
4. Drexler JF, Gloza-Rausch F, Glende J, Corman VM, Muth D, Goettsche M, Seebens A, Niedrig M, Pfefferle S, Yordanov S, Zhelyazkov L, Hermanns U, Vallo P, Lukashev A, Muller MA, Deng H, Herrler G, Drosten C. 2010. Genomic characterization of severe acute respiratory syndrome-related coronavirus in European bats and classification of coronaviruses based on partial RNA-dependent RNA polymerase gene sequences. J Virol 84:11336–11349. doi:10.1128/JVI.00650-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
5. Tong S, Conrardy C, Ruone S, Kuzmin IV, Guo X, Tao Y, Niezgoda M, Haynes L, Agwanda B, Breiman RF, Anderson LJ, Rupprecht CE. 2009. Detection of novel SARS-like and other coronaviruses in bats from Kenya. Emerg Infect Dis 15:482–485. doi:10.3201/eid1503.081013. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
6. Lau SKP, Woo PCY, Li KSM, Huang Y, Tsoi HW, Wong BHL, Wong SSY, Leung SY, Chan KH, Yuen KY. 2005. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci U S A 102:14040–14045. doi:10.1073/pnas.0506735102. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Li WH, Zhang CS, Sui JH, Kuhn JH, Moore MJ, Luo SW, Wong SK, Huang IC, Xu KM, Vasilieva N, Murakami A, He YQ, Marasco WA, Guan Y, Choe HY, Farzan M. 2005. Receptor and viral determinants of SARS-coronavirus adaptation to human ACE2. EMBO J 24:1634–1643. doi:10.1038/sj.emboj.7600640. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
8. He B, Zhang Y, Xu L, Yang W, Yang F, Feng Y, Xia L, Zhou J, Zhen W, Feng Y, Guo H, Zhang H, Tu C. 2014. Identification of diverse alphacoronaviruses and genomic characterization of a novel severe acute respiratory syndrome-like coronavirus from bats in China. J Virol 88:7070–7082. doi:10.1128/JVI.00631-14. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Ren W, Li W, Yu M, Hao P, Zhang Y, Zhou P, Zhang S, Zhao G, Zhong Y, Wang S, Wang LF, Shi Z. 2006. Full-length genome sequences of two SARS-like coronaviruses in horseshoe bats and genetic variation analysis. J Gen Virol 87:3355–3359. doi:10.1099/vir.0.82220-0. [PubMed] [CrossRef] [Google Scholar]
10. Yang XL, Hu B, Wang B, Wang MN, Zhang Q, Zhang W, Wu LJ, Ge XY, Zhang YZ, Daszak P, Wang LF, Shi ZL. 2015. Isolation and characterization of a novel bat coronavirus closely related to the direct progenitor of severe acute respiratory syndrome coronavirus. J Virol 90:3253–3256. [PMC free article] [PubMed] [Google Scholar]
11. Lau SK, Li KS, Huang Y, Shek CT, Tse H, Wang M, Choi GK, Xu H, Lam CS, Guo R, Chan KH, Zheng BJ, Woo PC, Yuen KY. 2010. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J Virol 84:2808–2819. doi:10.1128/JVI.02219-09. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Menachery VD, Yount BL Jr, Debbink K, Agnihothram S, Gralinski LE, Plante JA, Graham RL, Scobey T, Ge XY, Donaldson EF, Randell SH, Lanzavecchia A, Marasco WA, Shi ZL, Baric RS. 2015. A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence. Nat Med 21:1508–1513. doi:10.1038/nm.3985. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. Menachery VD, Yount BL Jr, Sims AC, Debbink K, Agnihothram SS, Gralinski LE, Graham RL, Scobey T, Plante JA, Royal SR, Swanstrom J, Sheahan TP, Pickles RJ, Corti D, Randell SH, Lanzavecchia A, Marasco WA, Baric RS. 2016. SARS-like WIV1-CoV poised for human emergence. Proc Natl Acad Sci U S A doi:10.1073/pnas.1517719113. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. de Groot R, Baker S, Baric R, Enjuanes L, Gorbalenya A, Holmes K, Perlman S, Poon L, Rottier P, Talbot P, Woo P, Ziebuhr J. 2012. Family Coronaviridae, p 806–828. In King A, Adams M, Cartens E, Lefkowitz E (ed), Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, CA. [Google Scholar]
15. Woo PC, Lau SK, Lam CS, Lau CC, Tsang AK, Lau JH, Bai R, Teng JL, Tsang CC, Wang M, Zheng BJ, Chan KH, Yuen KY. 2012. Discovery of seven novel mammalian and avian coronaviruses in the genus Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. J Virol 86:3995–4008. doi:10.1128/JVI.06540-11. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
16. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Penaranda S, Bankamp B, Maher K, Chen MH, Tong SX, Tamin A, Lowe L, Frace M, DeRisi JL, Chen Q, Wang D, Erdman DD, Peret TCT, Burns C, Ksiazek TG, Rollin PE, Sanchez A, Liffick S, Holloway B, Limor J, McCaustland K, Olsen-Rasmussen M, Fouchier R, Gunther S, Osterhaus ADME, Drosten C, Pallansch MA, Anderson LJ, Bellini WJ. 2003. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 300:1394–1399. doi:10.1126/science.1085952. [PubMed] [CrossRef] [Google Scholar]
17. Li WD, Shi ZL, Yu M, Ren WZ, Smith C, Epstein JH, Wang HZ, Crameri G, Hu ZH, Zhang HJ, Zhang JH, McEachern J, Field H, Daszak P, Eaton BT, Zhang SY, Wang LF. 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science 310:676–679. doi:10.1126/science.1118391. [PubMed] [CrossRef] [Google Scholar]
18. Yount B, Roberts RS, Sims AC, Deming D, Frieman MB, Sparks J, Denison MR, Davis N, Baric RS. 2005. Severe acute respiratory syndrome coronavirus group-specific open reading frames encode nonessential functions for replication in cell cultures and mice. J Virol 79:14909–14922. doi:10.1128/JVI.79.23.14909-14922.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
19. Liu DX, Fung TS, Chong KK-L, Shukla A, Hilgenfeld R. 2014. Accessory proteins of SARS-CoV and other coronaviruses. Antiviral Res 109:97–109. doi:10.1016/j.antiviral.2014.06.013. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
20. Kopecky-Bromberg SA, Martinez-Sobrido L, Frieman M, Baric RA, Palese P. 2007. Severe acute respiratory syndrome coronavirus open reading frame (ORF) 3b, ORF 6, and nucleocapsid proteins function as interferon antagonists. J Virol 81:548–557. doi:10.1128/JVI.01782-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
21. Minakshi R, Padhan K, Rani M, Khan N, Ahmad F, Jameel S. 2009. The SARS coronavirus 3a protein causes endoplasmic reticulum stress and induces ligand-independent downregulation of the type 1 interferon receptor. PLoS One 4:e8342. doi:10.1371/journal.pone.0008342. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
22. Obitsu S, Ahmed N, Nishitsuji H, Hasegawa A, Nakahama K, Morita I, Nishigaki K, Hayashi T, Masuda T, Kannagi M. 2009. Potential enhancement of osteoclastogenesis by severe acute respiratory syndrome coronavirus 3a/X1 protein. Arch Virol 154:1457–1464. doi:10.1007/s00705-009-0472-z. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Kanzawa N, Nishigaki K, Hayashi T, Ishii Y, Furukawa S, Niiro A, Yasui F, Kohara M, Morita K, Matsushima K, Le MQ, Masuda T, Kannagi M. 2006. Augmentation of chemokine production by severe acute respiratory syndrome coronavirus 3a/X1 and 7a/X4 proteins through NF-kappaB activation. FEBS Lett 580:6807–6812. doi:10.1016/j.febslet.2006.11.046. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
24. Zhou P, Li H, Wang H, Wang LF, Shi Z. 2012. Bat severe acute respiratory syndrome-like coronavirus ORF3b homologues display different interferon antagonist activities. J Gen Virol 93:275–281. doi:10.1099/vir.0.033589-0. [PubMed] [CrossRef] [Google Scholar]
25. Ren W, Qu X, Li W, Han Z, Yu M, Zhou P, Zhang SY, Wang LF, Deng H, Shi Z. 2008. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. J Virol 82:1899–1907. doi:10.1128/JVI.01085-07. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Perrotta AT, Been MD. 1991. A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature 350:434–436. doi:10.1038/350434a0. [PubMed] [CrossRef] [Google Scholar]
27. Santoro MG, Rossi A, Amici C. 2003. NF-kappaB and virus infection: who controls whom. EMBO J 22:2552–2560. doi:10.1093/emboj/cdg267. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
28. DeDiego ML, Nieto-Torres JL, Jimenez-Guardeño JM, Regla-Nava JA, Castaño-Rodriguez C, Fernandez-Delgado R, Usera F, Enjuanes L. 2014. Coronavirus virulence genes with main focus on SARS-CoV envelope gene. Virus Res 194:124–137. doi:10.1016/j.virusres.2014.07.024. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
29. Almazan F, Gonzalez JM, Penzes Z, Izeta A, Calvo E, Plana-Duran J, Enjuanes L. 2000. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci U S A 97:5516–5521. doi:10.1073/pnas.97.10.5516. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
30. Yount B, Curtis KM, Baric RS. 2000. Strategy for systematic assembly of large RNA and DNA genomes: transmissible gastroenteritis virus model. J Virol 74:10600–10611. doi:10.1128/JVI.74.22.10600-10611.2000. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
31. Donaldson EF, Sims AC, Baric RS. 2008. Systematic assembly and genetic manipulation of the mouse hepatitis virus A59 genome. Methods Mol Biol 454:293–315. doi:10.1007/978-1-59745-181-9_21. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
32. Fung TS, Liu DX. 2014. Coronavirus infection, ER stress, apoptosis and innate immunity. Front Microbiol 5:296. doi:10.3389/fmicb.2014.00296. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
33. Chaudhari N, Talwar P, Parimisetty A, Lefebvre d' Hellencourt C, Ravanan P. 2014. A molecular web: endoplasmic reticulum stress, inflammation, and oxidative stress. Front Cell Neurosci 8:213. doi:10.3389/fncel.2014.00213. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
34. Baker ML, Schountz T, Wang LF. 2013. Antiviral immune responses of bats: a review. Zoonoses Public Health 60:104–116. doi:10.1111/j.1863-2378.2012.01528.x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 7:12 am

Part 1 of 2

Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus
by Ben Hu, Data curation, Formal analysis, Investigation, Validation, Visualization, Writing – original draft,#1 Lei-Ping Zeng, Investigation, Methodology, Xing-Lou Yang, Investigation, Resources, Xing-Yi Ge, Formal analysis, Resources, Wei Zhang, Investigation, Bei Li, Investigation, Jia-Zheng Xie, Investigation, Xu-Rui Shen, Investigation, Yun-Zhi Zhang, Resources, Ning Wang, Investigation,1 Dong-Sheng Luo, Investigation, Resources,1 Xiao-Shuang Zheng, Investigation, Mei-Niang Wang, Resources,1 Peter Daszak, Funding acquisition, Writing – review & editing, Lin-Fa Wang, Conceptualization, Funding acquisition, Writing – review & editing, Jie Cui, Conceptualization, Formal analysis, Funding acquisition, Software, Writing – review & editing, and Zheng-Li Shi, Conceptualization, Funding acquisition, Methodology, Project administration, Supervision, Visualization, Writing – review & editing
Christian Drosten, Editor
Copyright © 2017 Hu et al

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


There have been three publications, in 2015,30 2016 and 2017, describing the WIV gain of function research. The WIV, having learned both basic and traceless infectious-clone technology from joint research with a laboratory at the University of North Carolina (UNC) in 2015, initiated construction of novel chimeric coronaviruses without UNC immediately thereafter. WIV’s first publication on the use of basic infectious-clone technology to construct novel chimeric coronaviruses at WIV appeared in 2016.31 WIV’s first publication on the use of traceless, signature-free infectious-clone technology also appeared in 2016.32

-- Did the SARS-CoV-2 virus arise from a bat coronavirus research program in a Chinese laboratory? Very possibly, by Milton Leitenberg


Abstract

A large number of SARS-related coronaviruses (SARSr-CoV) have been detected in horseshoe bats since 2005 in different areas of China. However, these bat SARSr-CoVs show sequence differences from SARS coronavirus (SARS-CoV) in different genes (S, ORF8, ORF3, etc) and are considered unlikely to represent the direct progenitor of SARS-CoV. Herein, we report the findings of our 5-year surveillance of SARSr-CoVs in a cave inhabited by multiple species of horseshoe bats in Yunnan Province, China. The full-length genomes of 11 newly discovered SARSr-CoV strains, together with our previous findings, reveals that the SARSr-CoVs circulating in this single location are highly diverse in the S gene, ORF3 and ORF8. Importantly, strains with high genetic similarity to SARS-CoV in the hypervariable N-terminal domain (NTD) and receptor-binding domain (RBD) of the S1 gene, the ORF3 and ORF8 region, respectively, were all discovered in this cave. In addition, we report the first discovery of bat SARSr-CoVs highly similar to human SARS-CoV in ORF3b and in the split ORF8a and 8b. Moreover, SARSr-CoV strains from this cave were more closely related to SARS-CoV in the non-structural protein genes ORF1a and 1b compared with those detected elsewhere. Recombination analysis shows evidence of frequent recombination events within the S gene and around the ORF8 between these SARSr-CoVs. We hypothesize that the direct progenitor of SARS-CoV may have originated after sequential recombination events between the precursors of these SARSr-CoVs. Cell entry studies demonstrated that three newly identified SARSr-CoVs with different S protein sequences are all able to use human ACE2 as the receptor, further exhibiting the close relationship between strains in this cave and SARS-CoV. This work provides new insights into the origin and evolution of SARS-CoV and highlights the necessity of preparedness for future emergence of SARS-like diseases.

Author summary

Increasing evidence has been gathered to support the bat origin of SARS coronavirus (SARS-CoV) in the past decade. However, none of the currently known bat SARSr-CoVs is thought to be the direct ancestor of SARS-CoV. Herein, we report the identification of a diverse group of bat SARSr-CoVs in a single cave in Yunnan, China. Importantly, all of the building blocks of SARS-CoV genome, including the highly variable S gene, ORF8 and ORF3, could be found in the genomes of different SARSr-CoV strains from this single location. Based on the analysis of full-length genome sequences of the newly identified bat SARSr-CoVs, we speculate that the direct ancestor of SARS-CoV may have arisen from sequential recombination events between the precursors of these bat SARSr-CoVs prior to spillover to an intermediate host. In addition, we found bat SARSr-CoV strains with different S proteins that can all use the receptor of SARS-CoV in humans (ACE2) for cell entry, suggesting diverse SARSr-CoVs capable of direct transmission to humans are circulating in bats in this cave. Our current study therefore offers a clearer picture on the evolutionary origin of SARS-CoV and highlights the risk of future emergence of SARS-like diseases.

Introduction

Severe Acute Respiratory Syndrome (SARS) is a severe emerging viral disease with high fatality characterized by fever, headache and severe respiratory symptoms including cough, dyspnea and pneumonia [1]. Due to its high transmissibility among humans, after its first emergence in southern China in late 2002, it rapidly led to a global pandemic in 2003 and was marked as one of the most significant public health threats in the 21st century [2,3]. The causative agent, SARS coronavirus (SARS-CoV), has been previously assigned to group 2b CoV and is now a member of the lineage B of genus Betacoronavirus in the family Coronaviridae [4]. It shares similar genome organization with other coronaviruses, but exhibits a unique genomic structure which includes a number of specific accessory genes, including ORF3a, 3b, ORF6, ORF7a, 7b, ORF8a, 8b and 9b [5,6].

Masked palm civets (Paguma larvata) were initially hypothesized to be the animal origin of SARS-CoV [7,8]. However, since a large number of genetically diverse SARS-related coronaviruses (SARSr-CoV) have been detected in multiple species of horseshoe bats (genus Rhinolophus) from different areas of China and Europe in the aftermath of SARS, it is prevailingly considered that SARS-CoV originated in horseshoe bats with civets acting as the intermediate amplifying and transmitting host [9–16]. Recently we have reported four novel SARSr-CoVs from Chinese horseshoe bats that shared much higher genomic sequence similarity to the epidemic strains, particularly in their S gene, of which two strains (termed WIV1 and WIV16) have been successfully cultured in vitro [17,18]. These newly identified SARSr-CoVs have been demonstrated to use the same cellular receptor (angiotensin converting enzyme-2 [ACE-2]) as SARS-CoV does and replicate efficiently in primary human airway cells [17–19].

Despite the cumulative evidence for the emergence of SARS-CoV from bats, all bat SARSr-CoVs described so far are clearly distinct from SARS-CoV in the S gene and/or one or more accessory genes such as ORF3 and ORF8, suggesting they are likely not the direct ancestor of SARS-CoV. Thus a critical gap remains in our understanding of how and where SARS-CoV originated from bat reservoirs. Previously, we reported a number of bat SARSr-CoVs with diverse S protein sequences from a single cave in Yunnan Province, including the four strains mentioned above most closely related to SARS-CoV [17,18]. Here we report the latest results of our 5-year longitudinal surveillance of bat SARSr-CoVs in this single location and systematic evolutionary analysis using full-length genome sequences of 15 SARSr-CoV strains (11 novel ones and 4 from previous studies). Efficiency of human ACE2 usage and the functions of accessory genes ORF8 and 8a were also evaluated for some of the newly identified strains.

Results

Continued circulation of diverse SARSr-CoVs in bats from a single location


We have carried out a five-year longitudinal surveillance (April 2011 to October 2015) on SARSr-CoVs in bats from a single habitat in proximity to Kunming city, Yunnan province, China, which was mainly inhabited by horseshoe bats. A total of 602 alimentary specimens (anal swabs or feces) were collected and tested for the presence of CoVs by a Pan-CoV RT-PCR targeting the 440-nt RdRp fragment that is conserved among all known α- and β-CoVs [20]. In total, 84 samples tested positive for CoVs. Sequencing of the PCR amplicons revealed the presence of SARSr-CoVs in the majority (64/84) of the CoV-positive samples (Table 1). Host species identification by amplification of either Cytb or ND1 gene suggested that most (57/64) of the SARSr-CoV positive samples were from Rhinolophus sinicus, while the remaining 7 samples were from Rhinolophus ferrumequinum, Rhinolophus affinis and from Aselliscus stoliczkanus which belongs to the family Hipposideridae.

Table 1: Summary of SARSr-CoV detection in bats from a single habitat in Kunming, Yunnan.

Sampling time / Sample type / Sample Numbers / SARSr-CoV + bat species (No.)

Total CoV + SARSr-CoV +


April, 2011 / anal swab / 14 / 1 / 1 / R. sinicus (1)
October, 2011 / anal swab / 8 / 3 / 3 / R. sinicus (3)
May, 2012 / anal swab & feces / 54 / 9 / 4 / R. sinicus (4)
September, 2012 / feces / 39 / 20 / 19 / R. sinicus (16); R. ferrumequinum (3)
April, 2013 / feces / 52 / 21 / 16 / R. sinicus (16)
July, 2013 / anal swab & feces / 115 / 9 / 8 / R. sinicus (8)
May, 2014 / feces / 131 / 8 / 4 / A. stoliczkamus (3); R. affinis (1)
October, 2014 / anal swab / 19 / 4 / 4 / R. sinicus (4)
May, 2015 / feces / 145 / 3 / 0 / --
October, 2015 / anal swab / 25 / 6 / 5 / R. sinicus (5)
Total / -- / 602 / 84 / 64 / R (61) A (3)


Based on the preliminary analysis of the partial RdRp sequences, all of the 64 bat SARSr-CoV sequences showed high similarity among themselves and with other reported bat SARSr-CoVs and SARS-CoVs from humans and civets. To understand the genetic diversity of these bat SARSr-CoVs, the most variable region of the SARSr-CoV S gene, corresponding to the receptor-binding domain (RBD) of SARS-CoV, were amplified and sequenced. Due to low viral load in some samples, RBD sequences were successfully amplified only from 49 samples. These RBD sequences displayed high genetic diversity and could be divided into two large clades, both of which included multiple genotypes. Clade 1 strains shared an identical size and higher amino acid (aa) sequence identity with SARS-CoV RBD, while clade 2 had a shorter size than SARS-CoV S due to two deletions (5 and 12–13 aa, respectively) (S1 Fig). Co-infections by two strains of different clades were detected in two samples, Rs3262 and Rs4087 (S1 Fig).

Genomic characterization of the novel SARSr-CoVs

Based on the diversity of RBD sequences, 11 novel SARSr-CoV strains named by abbreviation of bat species and sample ID (Rs4081, Rs4084, Rs4231, Rs4237, Rs4247, Rs4255, Rs4874, Rs7327, Rs9401, Rf4092 and As6526) were selected for full-length genomic sequencing based on sample abundance, genotype of RBD as well as sampling time. For each RBD genotype and each time of sampling, at least one representative strain was selected. The genome size of these novel SARSr-CoVs ranged from 29694 to 30291 nucleotides (nt). This gave a total of 15 full-length genomes of bat SARSr-CoVs from this single location (13 from R.sinicus, and one each from R. ferrumequinum and A. stoliczkanus), including our previously reported strains, Rs3367, RsSHC014, WIV1 and WIV16 [17,18]. The genomes of all 15 SARSr-CoVs circulating in this single cave shared 92.0% to 99.9% nt sequence identity. The overall nt sequence identity between these SARSr-CoVs and human and civet SARS-CoVs is 93.2% to 96%, significantly higher than that observed for bat SARSr-CoVs reported from other locations in China (88–93%) [9,10,12,14,21,22]. The genome sequence similarity among the 15 SARSr-CoVs and SARS-CoV SZ3 strain was examined by Simplot analysis (Fig 1). The 15 SARSr-CoVs are highly conserved and share a uniformly high sequence similarity to SARS-CoV in the non-structural gene ORF1a (96.6% to 97.1% nt sequence identity, 98.0% to 98.3% aa sequence identity) and ORF1b (96.1% to 96.6% nt sequence identity, 99.0% to 99.4% aa sequence identity). In contrast, a considerable genetic diversity is shown in the S gene (corresponding to SZ3 genome position 21477 to 25244) and ORF8 (corresponding to SZ3 genome position 27764 to 28132) (Fig 1).

Image
Fig 1. Similarity plot based on the full-length genome sequence of civet SARS CoV SZ3.
Full-length genome sequences of all SARSr-CoV detected in bats from the cave investigated in this study were used as reference sequences. The analysis was performed with the Kimura model, a window size of 1500 base pairs and a step size of 150 base pairs.


The 11 novel SARSr-CoVs identified from this single location generally shared similar genome organization with SARS-CoV and other bat SARSr-CoVs. In our previous study, we identified an additional ORF termed ORFx present between ORF6 and ORF7 in strain WIV1 and WIV16 [18,23]. In this study, ORFx was also found in the genomes of Rs7327 and Rs4874. Compared with that of WIV1 and WIV16, the length of ORFx in Rs7327 and Rs4874 was extended to 510 nt due to a deletion of 2 nt in a poly-T sequence that resulted in a shift of reading frame (Fig 2 and S2 Fig).

Image
Fig 2. Schematic diagram illustrating the genomic regions or ORFs with most variation between different SARS-CoV and SARSr-CoV isolates.
Coding regions of the N-terminal domain (NTD) and receptor-binding domain (RBD) of the spike protein, ORF3a/b and ORF8 (8a/b) in bat SARSr-CoV genomes highly similar to those in SARS CoV genome are indicated with black boxes or arrows while the hollow boxes or arrows represent corresponding regions with less sequence similarity to those of SARS-CoV. The deletions in the RBD of some SARSr-CoVs are indicated by two vertical lines.


Co-circulation of different bat SARSr-CoVs with S, ORF8 and ORF3 sequences similar to those in SARS-CoV at a single location

The primary difference between SARS-CoV and most bat SARSr-CoVs is located in S gene. The S protein is functionally divided into two subunits, denoted S1 and S2, which is responsible for receptor binding and cellular membrane fusion, respectively. S1 consists of two domains, the N-terminal domain (NTD) and C-terminal domain (CTD) which is also known as the RBD in SARS-CoV [24]. SARS-CoV and bat SARSr-CoVs share high sequence identity in the S2 region in contrast to the S1 region. Among the 15 SARSr-CoVs identified from bats in the surveyed cave, six strains with deletions in their RBD regions (Rs4081, Rs4237, Rs4247, Rs4255, Rf4092 and As6526) showed 78.2% to 80.2% aa sequence identity to SARS-CoV in the S protein, while the other nine strains without deletions were much more closely related to SARS-CoV, with 90.0% (Rs4084) to 97.2% (Rs4874) aa sequence identity. These nine SARSr-CoVs can be further divided into four genotypes according to their S1 sequences (Fig 2): RsSHC014/Rs4084 showed more genetic differences from SARS-CoV in both NTD and RBD regions; The RBD sequences of SARSr-CoV Rs7327, Rs9401 and previously reported WIV1/Rs3367 closely resembled that of SARS-CoV. However, they were distinct from SARS-CoV but similar to RsSHC014 in NTD. In contrast, we found a novel SARSr-CoV, termed Rs4231, which shared highly similar NTD, but not RBD sequence with SARS-CoV (Figs ​(Figs22 and ​and3).3). Its S protein showed 94.6% to 95% aa sequence identity to those of human and civet SARS-CoVs (S1 Table). Strains with both NTD and RBD highly homologous to those of SARS-CoV were also present in this cave. In addition to WIV16 which we described previously [18], Rs4874 was also found to have the S protein closest to SARS-CoV S (> 97% aa sequence identity) of all the bat SARSr-CoVs reported to date (Figs ​(Figs22 and ​and3).3). In addition to the SARSr-CoVs subjected to full-length genome sequencing, we also obtained the RBD and NTD sequences from other samples collected in this cave. The sequences with high identity to SARS-CoV RBD were amplified from 10 more R. sinicus samples. SARSr-CoVs with this genotype of RBD were detected in different seasons throughout the five years. Strains containing the NTD similar to SARS-CoV were only found in 2013 (S2 Table).

Image
Fig 3. Amino acid sequence comparison of the S1 subunit (corresponding to aa 1–660 of the spike protein of SARS-CoV).
The receptor-binding domain (aa 318–510) of SARS-CoV and the homologous region of bat SARSr-CoVs are indicated by the red box. The key aa residues involved in the interaction with human ACE2 are numbered on top of the aligned sequences. SARS-CoV GZ02, BJ01 and Tor2 were isolated from patients in the early, middle and late phase, respectively, of the SARS outbreak in 2003. SARS-CoV SZ3 was identified from civets in 2003. SARSr-CoV Rs 672 and YN2013 were identified from R. sinicus collected in Guizhou and Yunnan Province, respectively. SARSr-CoV Rf1 and JL2012 were identified from R. ferrumequinum collected in Hubei and Jilin Province, respectively. WIV1, WIV16, RsSHC014, Rs4081, Rs4084, Rs4231, Rs4237, Rs4247, Rs7327 and Rs4874 were identified from R.sinicus, and Rf4092 from R. ferrumequinum in the cave surveyed in this study.


ORF8 is another highly variable gene among different SARS-CoV and SARSr-CoV strains [25,26]. We aligned the ORF8 nt sequences of the representative SARSr-CoVs discovered in this surveillance with those of other SARSr-CoVs and SARS-CoVs (Fig 4). Though WIV16, WIV1, Rs4231 and RsSHC014 were genetically closer to SARS-CoV in S gene, they contained a single 366-nt ORF8 without the 29-nt deletion present in most human SARS-CoVs and showed only 47.1% to 51.0% nt sequence identity to human and civet SARS-CoVs. However, the ORF8 of strain Rf4092 from R. ferrumequinum exhibited high similarity to that of civet SARS-CoV. It possessed a single long ORF8 of the same length (369 nt) as that of civet SARS-CoV strain SZ3, with only 10 nt mutations and 3 aa mutations detected (Fig 4). Similar ORF8 sequences were also amplified from other 7 samples collected in the cave during 2011 to 2013, from both R. ferrumequinum and R. sinicus (S2 Table). The ORF8 of Rs4084 was highly similar to Rf4092’s but was split into two overlapping ORFs, ORF8a and ORF8b, due to a short 5-nt deletion (Figs ​(Figs22 and ​and4).4). The position of start codons and stop codons of the two ORFs were consistent with those in most human SARS-CoV strains. Excluding the 8-aa insertion, Rs4084 and SARS-CoV strain BJ01 displayed identical aa sequence of ORF8a, and only three different aa residues were observed between their ORF8b (Fig 4). To our knowledge, Rs4084 was the first bat SARSr-CoV reported that resembled the late human SARS-CoVs in both ORF8 gene organization and sequence.

Image
Fig 4. Alignment of nucleotide sequences of ORF8 or ORF8a/8b.
The start codons and stop codons of ORF8, 8a and 8b are marked with black boxes and the forward and reverse arrows, respectively. The deletion responsible for the split ORF8a and 8b in human SARS-CoV BJ01, Tor2 and bat SARSr-CoV Rs4084 is marked with red boxes. See the legend for Fig 3 for the origin of various sequences used in this alignment.


Another key difference between SARS-CoV and bat SARSr-CoV genomes is the ORF3 coding region [10,17,21]. We analyzed the ORF3a sequences amplified from 42 samples and found that most of the SARSr-CoVs closely related to SARS-CoV in the S gene shared higher ORF3a sequence similarity (96.4% to 98.9% aa identity) with SARS-CoV (S3 Fig and S2 Table). The ORF3b of SARS CoV, sharing a large part of its coding sequence with the ORF3a, encodes a 154-aa protein [27], but it is truncated to different extents at the C-terminal in previously described bat SARSr-CoVs including WIV1 and WIV16 (S4 Fig). In the current study, we identified a non-truncated ORF3b for the first time (Rs7327), which maintained the nuclear localization signal at its C-terminal. Moreover, it shared 98.1% aa sequence identity with SARS-CoV strain Tor2 with only three aa substitutions (S4 Fig). Thus, Rs7327 is the bat SARSr-CoV most similar to SARS-CoV in the ORF3 region known to date.

Recombination analysis

The full-length genome sequences of all 15 SARSr-CoVs from the surveyed cave were screened for evidence of potential recombination events. Both similarity plot and bootscan analyses revealed frequent recombination events among these SARSr-CoV strains. It was suggested that WIV16, the closest progenitor of human SARS-CoV known to date [18], was likely to be a recombinant strain from three SARSr-CoVs harbored by bats in the same cave, namely WIV1, Rs4231 and Rs4081, with strong P value (<10−30). Breakpoints were identified at genome positions nt 18391, 22615 and 28160 (Fig 5A). In the genomic region between nt 22615 and 28160, which contained the region encoding the RBD and the S2 subunit of the S protein, WIV16 was highly similar to WIV1, sharing 99% sequence identity. In contrast, in the region between nt 18391 and 22615, which covered a part of ORF1b and the region encoding the NTD of the S gene, WIV16 showed substantially closer relationship to Rs4231. Meanwhile, the ORF1ab sequences upstream from nt 18391 of WIV16 displayed the highest genetic similarity (99.8% nt sequence identity) to that of Rs4081.

Image
Fig 5. Detection of potential recombination events by similarity plot and boot scan analysis.
(A) Full-length genome sequence of SARSr-CoV WIV16 was used as query sequence and WIV1, Rs4231 and Rs4081 as reference sequences. (B) Full-length genome sequence of SARS-CoV SZ3 was used as query sequence and SARSr-CoV WIV16, Rf4092 and Rs4081 as reference sequences. All analyses were performed with a Kimura model, a window size of 1500 base pairs, and a step size of 150 base pairs. The gene map of query genome sequences are used to position breakpoints.


Evidence of recombination event was also detected in the genome of the novel SARSr-CoV Rs4084, which had a unique genome organization with split ORF8a and 8b. The previously reported strain RsSHC014 and the newly identified strain Rf4092 were suggested to be the major and minor parent of Rs4084, respectively (P value < 10−80). The breakpoint was located at nt 26796 (S5 Fig). In the region downstream of the breakpoint including ORF8, Rs4084 showed closet genetic relationship with Rf4092, sharing 98.9% nt sequence identity, while it shared the highest nt sequence identity (99.4%) with RsSHC014 in the majority of its genome upstream from the breakpoint.

When civet SARS-CoV SZ3 was used as the query sequence in similarity plot and bootscan analysis, evidence for recombination events was also detected (Fig 5B). In the region between the two breakpoints at the genome positions nt 21161 and nt 27766, including the S gene, closer genetic relationship between SZ3 and WIV16 was observed. However, from position nt 27766 towards the 3’ end of its genome, a notably close genetic relationship was observed between SZ3 and Rf4092 instead. Throughout the non-structural gene, moreover, SZ3 shared a similarly high sequence identity with WIV16 and Rf4092. It indicates that civet SARS-CoV was likely to be the descendent from a recombinant of the precursors of WIV16 and Rf4092, or that the SARSr-CoVs found in this cave, like WIV16 or Rf4092, may have been the descendants of the SARS-CoV lineage.

Phylogenetic analysis

Phylogenetic trees were constructed using the nt sequences of nonstructural protein gene ORF1a and ORF1b. Unlike the high genetic diversity in the S gene, nearly all SARSr-CoVs from the bat cave we surveyed were closely clustered, and showed closer phylogenetic relationship to SARS-CoV than the majority of currently known bat SARSr-CoVs discovered from other locations, except YNLF_31C and 34C which were recently reported in greater horseshoe bats from another location in Yunnan [22] (Fig 6). The phylogeny of SARSr-CoVs in ORF1a and ORF1b appeared to be associated with their geographical distribution rather than with host species. Regardless of different host bat species, SARS-CoV and SARSr-CoVs detected in bats from southwestern China (Yunnan, Guizhou and Guangxi province) formed one clade, in which SARSr-CoV strains showing closer relationship to SARS-CoV were all from Yunnan. SARSr-CoVs detected in southeastern, central and northern provinces, such as Hong Kong, Hubei and Shaanxi, formed the other clade which was phylogenetically distant to human and civet SARS-CoVs (Fig 6 and S6 Fig).

Image
Fig 6. Phylogenetic trees based on nucleotide sequences of ORF1a (A) and ORF1b (B). The trees were constructed by the maximum likelihood method using the LG model with bootstrap values determined by 1000 replicates. Only bootstraps > 50% are shown. The scale bars represent 0.03 (A) and 0.02 (B) substitutions per nucleotide position. Rs, Rhinolophus sinicus; Rf, Rhinolophus ferremequinum; Rm, Rhinolophus macrotis; Ra, Rhinolophus affinis; Rp, Rhinolophus pusillus; As, Aselliscus stoliczkanus; Cp, Chaerephon plicata. SARSr-CoVs detected in bats from the single cave surveyed in this study are in bold. Sequences detected in southwestern China are indicated in red.

Rescue of bat SARSr-CoVs and virus infectivity experiments

In the current study, we successfully cultured an additional novel SARSr-CoV Rs4874 from a single fecal sample using an optimized protocol and Vero E6 cells [17]. Its S protein shared 99.9% aa sequence identity with that of previously isolated WIV16 and it was identical to WIV16 in RBD. Using the reverse genetics technique we previously developed for WIV1 [23], we constructed a group of infectious bacterial artificial chromosome (BAC) clones with the backbone of WIV1 and variants of S genes from 8 different bat SARSr-CoVs. Only the infectious clones for Rs4231 and Rs7327 led to cytopathic effects in Vero E6 cells after transfection (S7 Fig). The other six strains with deletions in the RBD region, Rf4075, Rs4081, Rs4085, Rs4235, As6526 and Rp3 (S1 Fig) failed to be rescued, as no cytopathic effects was observed and viral replication cannot be detected by immunofluorescence assay in Vero E6 cells (S7 Fig). In contrast, when Vero E6 cells were respectively infected with the two successfully rescued chimeric SARSr-CoVs, WIV1-Rs4231S and WIV1-Rs7327S, and the newly isolated Rs4874, efficient virus replication was detected in all infections (Fig 7). To assess whether the three novel SARSr-CoVs can use human ACE2 as a cellular entry receptor, we conducted virus infectivity studies using HeLa cells with or without the expression of human ACE2. All viruses replicated efficiently in the human ACE2-expressing cells. The results were further confirmed by quantification of viral RNA using real-time RT-PCR (Fig 8).

Image
Fig 7. Infection of Vero E6 cells by bat SARSr-CoV WIV1, Rs4874, WIV1-Rs4231S and WIV1-Rs7327S.
(A) The successful infection was confirmed by immunofluorescent antibody staining using rabbit antibody against the SARSr-CoV Rp3 nucleocapsid protein. The columns (from left to right) show staining of nuclei (blue), virus replication (red), and both nuclei and virus replication (merged double-stain images). (B) The growth curves in Vero E6 cells with a MOI of 1.0 and 0.01.


Image
Fig 8. Analysis of receptor usage by immunofluorescence assay (A) and real-time PCR (B). Virus infectivity of Rs4874, WIV1-Rs4231S and WIV1-Rs7327S was determined in HeLa cells with and without the expression of human ACE2. ACE2 expression was detected with goat anti-human ACE2 antibody followed by fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat IgG. Virus replication was detected with rabbit antibody against the SARSr-CoV Rp3 nucleocapsid protein followed by cyanine 3 (Cy3)-conjugated mouse anti-rabbit IgG. Nuclei were stained with DAPI (49,6-diamidino-2-phenylindole).The columns (from left to right) show staining of nuclei (blue), ACE2 expression (green), virus replication (red) and the merged triple-stained images, respectively.

Activation of activating transcription factor 6 (ATF6) by the ORF8 proteins of different bat SARSr-CoVs

The induction of the ATF6-dependent transcription by the ORF8s of SARS-CoV and bat SARSr-CoVs were investigated using a luciferase reporter, 5×ATF6-GL3. In HeLa cells transiently transfected with the expression plasmids of the ORF8s of bat SARSr-CoV Rf1, Rf4092 and WIV1, the relative luciferase activities of the 5×ATF6-GL3 reporter was enhanced by 5.56 to 9.26 folds compared with cells transfected with the pCAGGS empty vector, while it was increased by 4.42 fold by the SARS-CoV GZ02 ORF8. As a control, the treatment with tunicamyxin (TM) stimulated the transcription by about 11 folds (Fig 9A). The results suggests that various ORF8 proteins of bat SARSr-CoVs can activate ATF6, and those of some strains have a stronger effect than the SARS-CoV ORF8.

Image
Fig 9. Functional characterization of diverse ORF8 and ORF8a proteins of bat SARSr-CoVs.
(A) The ORF8 proteins of SARS-CoV and bat SARSr-CoVs induces the ATF6-dependent transcriptional activity. HeLa cells were transiently transfected with the pcAGGS expression plasmids of the ORF8 of SARS-CoV GZ02, bat SARSr-CoV Rf1, WIV1 and Rf4092 and the reporter plasmid 5×ATF6-GL3 for 40h. Control cells were co-transfected with the reporter plasmid and the empty pCAGGS vector for 24h, and treated with or without TM (2μg/ml) for an additional 16h. The cell lysates were harvested for dual luciferase assay and data are shown as the average values from triplicate wells. (B) The ORF8a proteins of SARS-CoV and bat SARSr-CoV triggered apoptosis. 293T cells were transfected with the expression plasmids of the ORF8a of SARS-CoV Tor2 and bat SARSr-CoV Rs4084 and a pcAGGS vector control for 24h. Apoptosis was analyzed by flow cytometry after annexin V staining and the percentage of apoptotic cells were calculated. Data are shown as the average values from triplicate cells. Error bars indicate SDs. * P<0.05.


Induction of apoptosis by the ORF8a of the newly identified bat SARSr-CoV

We conducted transient transfection to examine whether the ORF8a of SARSr-CoV Rs4084 triggered apoptosis. As shown in Fig 9B, 11.76% and 9.40% of the 293T cells transfected with the SARSr-CoV Rs4084-ORF8a and SARS-CoV Tor2-ORF8a expression plasmid underwent apoptosis, respectively. In contrast, transfection with the empty vector resulted in apoptosis in only 2.79% of the cells. The results indicate that Rs4084 ORF8a has an apoptosis induction activity similar to that of SARS-CoV [28].

Discussion

Genetically diverse SARSr-CoVs have been detected in various horseshoe bat species across a wide geographic range in China in the past decade [9–12,14,29]. However, most bat SARSr-CoVs show considerable genetic distance to SARS-CoV, particularly in the highly variable S1, ORF8 and ORF3 regions [10,25]. Recently, several novel SARSr-CoVs have been described to be more closely related to SARS-CoV, either in the S gene or in ORF8. The S proteins of RsSHC014, Rs3367, WIV1 and WIV16, which were reported in our previous studies, shared 90% to 97% aa sequence identities to those of human/civet SARS-CoVs [17,18]. Another strain from Rhinolophus affinis in Yunnan termed LYRa11 showed 90% aa sequence identity to SARS-CoV in the S gene [13]. In addition, two studies have described 4 novel SARSr-CoVs (YNLF_31C/34C and GX2013/YN2013) which possessed a full-length ORF8 with substantially higher similarity to that of SARS-CoV [22,30]. These findings provide strong genetic evidence for the bat origin of SARS-CoV with regard to the S gene or ORF8. However, all of these SARSr-CoVs were distinct from SARS-CoV in at least one other gene, suggesting that none of them was the immediate progenitor of SARS-CoV. Moreover, these SARSr-CoVs were discovered in bat populations from physically distinct locations. The site of origin of the true progenitor of SARS-CoV and the evolutionary origin of SARS-CoV have until now remained elusive. In the current study, we have identified a bat habitat potentially important for SARSr-CoV evolution where a series of recombination events have likely occurred among different SARSr-CoV strains, which provides new insights into the origin of SARS-CoV.

SARS first emerged in Guangdong province in late 2002 [7]. However, SARSr-CoVs discovered in bats from neighboring areas of Guangdong to date have shown phylogenetic disparity from SARS-CoV especially in the S gene [9,10,14], suggesting SARS-CoV may have originated from another region. Our analysis of the phylogeny of SARS-CoVs and all known bat SARSr-CoVs using the nt sequence of their non-structural ORF1a and ORF1b genes, which constitute the majority of the genome, shows that SARSr-CoV evolution is strongly correlated with their geographical origin, but not host species. It is noteworthy that SARSr-CoVs detected in Yunnan are more closely related to SARS-CoV than strains from other regions in China. This finding implies that Yunnan, or southwestern China, is more likely to be the geographical source of SARS-CoV than other regions in China, but data from more extensive surveillance are yet needed to support this inference.

In our longitudinal surveillance of SARSr-CoVs in a single cave in Yunnan where we discovered Rs3367, RsSHC014, WIV1 and WIV16,
the CoV prevalence in fecal samples varied among different sampling time. Generally, a higher prevalence was observed in autumn (September and October) than in spring and early summer (April and May). This may be due to the establishment of a susceptible subpopulation of newborn bats which had not developed their own immunity after the parturition period [31]. Another factor may be the changes in the composition of bat species in the cave at different sampling dates. For example, in September 2012 when the CoV prevalence reached 51.3%, the majority of samples were from R. sinicus, but in May 2015 when only 3 out of the 145 samples tested positive, Aselliscus stoliczkanus was the predominant bat species in the cave. We failed to amplify the RBD sequences from 15 of the 64 SARSr-CoV positive samples. Most of these samples had comparatively low viral concentration (< 107 copies/g) (S8 Fig), as revealed by our previous quantitative studies [32]. The unsuccessful amplification of RBD in some samples with high viral concentration was probably because of the more divergent sequences in this region of these SARSr-CoV genomes.

In this cave, we have now obtained full-length genome sequences of additional 11 novel SARSr-CoVs from bats. Our findings suggest the co-circulation of different bat SARSr-CoVs highly similar to SARS-CoV in the most variable S1 (NTD and RBD), ORF8 and ORF3 regions, respectively, in this single location. In the ORF1a, ORF1b, E, M and N genes, the SARSr-CoVs circulating in this cave also shared > 98% aa sequence identities with human/civet SARS-CoVs. Thus, all of the building blocks of the SARS-CoV genome were present in SARSr-CoVs from this single location in Yunnan during our sampling period. Furthermore, strains closely related to different representative bat SARSr-CoVs from other provinces (e.g. Rs672, HKU3 and Rf1) in the RBD region were also detected there. Therefore, this cave could be regarded as a rich gene pool of bat SARSr-CoVs, wherein concurrent circulation of a high diversity of SARSr-CoV strains has led to an unusually diverse assemblage of SARSr-CoVs.

During our 5-year surveillance in this single cave, we first reported Rs3367 and WIV1 in 2013, with RBD sequence closely resembling that of SARS-CoV [17]. More recently, we discovered WIV16 which had an RBD almost identical to WIV1’s but shared much higher similarity with SARS-CoV than WIV1 in the NTD region of S1, making it the closest SARSr-CoV to the epidemic strains identified to date [18]. In this study, we found a novel strain Rs4231 from the same location sharing almost identical NTD sequence with WIV16 but distinct from it in the RBD, with evidence of a recombination event. Our recombination analysis indicated that a recombination event may have taken place at the junction between the coding region of NTD and RBD in the Rs4231 and WIV1 genomes and resulted in WIV16. Recombination at this genomic position also happened among other SARSr-CoVs relatively distant to SARS-CoV found in this location (e.g. Rs4081 and Rs4247, S5 Fig). The frequent recombination at this hotspot in the S gene increased the genetic diversity of SARSr-CoVs harbored in these bat populations and might have been responsible for the generation of the S gene of the direct progenitor strain of SARS-CoV.

The genomes of SARS-CoVs from patients during the early epidemic phase and civet SARS-CoVs all contained a single full-length ORF8 [3,7]. We have found that a number of bat SARSr-CoVs from this cave possessed a complete ORF8 highly similar to that of early human/civet SARS-CoV (>97% nt sequence identity), represented by strain Rf4092 (S3C Fig). This provided further evidence for the source of human SARS-CoV ORF8 in bats [22,30]. In contrast, the ORF8 was split into overlapping ORF8a and ORF8b in most human SARS-CoV strains from later-phase patients due to the acquisition of a 29-nt deletion [8,26]. In this study, we have discovered for the first time a bat SARSr-CoV with ORF8a and ORF8b highly similar to the later-phase human SARS-CoVs, though the split of ORF8 in the bat SARSr-CoV and that in human SARS-CoV were two independent events. Our recombination analysis suggests that this strain, Rs4084, likely acquired its ORF8 from Rf4092 through recombination, followed by the development of the 5-nt deletion which led to the splitting. It suggests that ORF8 region in bat SARSr-CoV genomes is prone to deletions as in human SARS-CoV [3,25]. Finally, the recombination analysis suggests that an ancestral strain of SARS-CoV SZ3 would have been generated if the recombination around ORF8 had occurred between the lineages that led to WIV16 and Rf4092. Taken together, the evidence of recombination events among SARSr-CoVs harbored by bats in this single location suggests that the direct progenitor of SARS-CoV may have originated as a result of a series of recombination within the S gene and around ORF8. This could have been followed by the spillover from bats to civets and people either in the region, or during movement of infected animals through the wildlife trade. However, given the paucity of data on animal trade prior to the SARS outbreak, the likely high geographical sampling bias in bat surveillance for SARSr-CoVs in southern China, and the possibility that other caves harbor similar bat species assemblages and a rich diversity of SARSr-CoVs, a definite conclusion about the geographical origin of SARS-CoV cannot be drawn at this point.


R. sinicus are regarded as the primary natural host of SARS-CoV, as all SARSr-CoVs highly homologous to SARS-CoV in the S gene were predominantly found in this species. However, it is noted that two SARSr-CoVs previously reported from R. ferrumequinum showed the closest phylogenetic position to SARS-CoV in the ORF1a/1b trees. These strains were discovered in another location in Yunnan 80 km from the cave surveyed in the current study [22]. This information also supports the speculation that SARS-CoV may have originated from this region. Nonetheless, since the correlation between the host species and the phylogeny of SARSr-CoV ORF1ab seems limited, more SARSr-CoV sequences need to be obtained from different Rhinolophus bat species in both locations in Yunnan, and from other locations in southern China. In particular, it will be important to assess whether R. ferrumequinum played a more important role in the evolution of SARS-CoV ORF1ab.

The cave we studied is located approximately 60 km from the city of Kunming. Beside a number of rhinolophid and hipposiderid species from which SARSr-CoVs have been detected, other bats like myotis were also present there. The temperature in the cave is around 22–25°C and the humidity around 85%-90%. The physical nature of the cave is not unique, but it does appear to host a particularly dense population of bats in the reproductive season. Similar caves co-inhabited by bat populations of different species are not rare in other areas in Yunnan. We propose that efforts to study the ecology, host species diversity, and viral strain populations of these caves may provide critical information on what drives SARSr-CoV evolution.

Our previous studies demonstrated the capacity of both WIV1 and WIV16 to use ACE2 orthologs for cell entry and to efficiently replicate in human cells [17,18]. In this study, we confirmed the use of human ACE2 as receptor of two novel SARSr-CoVs by using chimeric viruses with the WIV1 backbone replaced with the S gene of the newly identified SARSr-CoVs. Rs7327’s S protein varied from that of WIV1 and WIV16 at three aa residues in the receptor-binding motif, including one contact residue (aa 484) with human ACE2. This difference did not seem to affect its entry and replication efficiency in human ACE2-expressing cells. A previous study using the SARS-CoV infectious clone showed that the RsSHC014 S protein could efficiently utilize human ACE2 [33], despite being distinct from SARS-CoV and WIV1 in the RBD (S1 Fig). We examined the infectivity of Rs4231, which shared similar RBD sequence with RsSHC014 but had a distinct NTD sequence, and found the chimeric virus WIV1-Rs4231S also readily replicated in HeLa cells expressing human ACE2 molecule. The novel live SARSr-CoV we isolated in the current study (Rs4874) has an S gene almost identical to that of WIV16. As expected, it is also capable of utilizing human ACE2. These results indicate that diverse variants of SARSr-CoV S protein without deletions in their RBD are able to use human ACE2. In contrast, our previous study revealed that the S protein of a R. sinicus SARSr-CoV with deletions (Rp3) failed to use human, civet and bat ACE2 for cell entry [34]. In this study, in addition to Rs4231 and Rs7327, we also constructed infectious clones with the S gene of Rs4081, Rf4075, Rs4085, Rs4235 and As6526, which all contained the deletions in their RBD. These 7 strains, plus Rs4874 and the previously studied WIV1 and RsSHC014, could represent all types of S variants of SARSr-CoVs in this location (S3A Fig). However, none of the strains with deletions in the RBD could be rescued from Vero E6 cells. Therefore, the two distinct clades of SARSr-CoV S gene may represent the usage of different receptors in their bat hosts.

The full-length ORF8 protein of SARS-CoV is a luminal endoplasmic reticulum (ER) membrane-associated protein that induces the activation of ATF6, an ER stress-regulated transcription factor that activates the transcription of ER chaperones involved in protein folding [35]. We amplified the ORF8 genes of Rf1, Rf4092 and WIV1, which represent three different genotypes of bat SARSr-CoV ORF8 (S3C Fig), and constructed the expression plasmids. All of the three ORF8 proteins transiently expressed in HeLa cells can stimulate the ATF6-dependent transcription. Among them, the WIV1 ORF8, which is highly divergent from the SARS-CoV ORF8, exhibited the strongest activation. The results indicate that the variants of bat SARSr-CoV ORF8 proteins may play a role in modulating ER stress by activating the ATF6 pathway. In addition, the ORF8a protein of SARS-CoV from the later phase has been demonstrated to induce apoptosis [28]. In this study, we have found that the ORF8a protein of the newly identified SARSr-CoV Rs4084, which contained an 8-aa insertion compared with the SARS-CoV ORF8a, significantly triggered apoptosis in 293T cells as well.

Compared with the 154-aa ORF3b of SARS-CoV, the ORF3b proteins of all previously identified bat SARSr-CoVs were smaller in size due to the early translation termination. However, for the first time, we discovered an ORF3b without the C-terminal truncation in a bat SARSr-CoV, Rs7327, which differed from the ORF 3b of SARS-CoV GZ02 strain at only one aa residue. The SARS-CoV ORF3b antagonizes interferon function by modulating the activity of IFN regulatory factor 3 (IRF3) [27]. As previous studies suggested, the nuclear localization signal-containing C-terminal may not be required for the IFN antagonist activity of ORF3b [36]. Our previous studies also demonstrated that the ORF3b protein of a bat SARSr-CoV, termed Rm1, which was C-terminally truncated to 56 aa and shared 62% aa sequence identity with SARS-CoV, still displayed the IFN antagonist activity [37]. It is very interesting to investigate in further studies whether Rs7327’s ORF3b and other versions of truncated ORF3b such as WIV1 and WIV16 also show IFN antagonism profiles.

As a whole, our findings from a 5-year longitudinal study conclusively demonstrate that all building blocks of the pandemic SARS-CoV genome are present in bat SARSr-CoVs from a single location in Yunnan. The data show that frequent recombination events have happened among those SARSr-CoVs in the same cave. While we cannot rule out the possibility that similar gene pools of SARSr-CoVs exist elsewhere, we have provided sufficient evidence to conclude that SARS-CoV most likely originated from horseshoe bats via recombination events among existing SARSr-CoVs. In addition, we have also revealed that various SARSr-CoVs capable of using human ACE2 are still circulating among bats in this region. Thus, the risk of spillover into people and emergence of a disease similar to SARS is possible. This is particularly important given that the nearest village to the bat cave we surveyed is only 1.1 km away, which indicates a potential risk of exposure to bats for the local residents. Thus, we propose that monitoring of SARSr-CoV evolution at this and other sites should continue, as well as examination of human behavioral risk for infection and serological surveys of people, to determine if spillover is already occurring at these sites and to design intervention strategies to avoid future disease emergence.
admin
Site Admin
 
Posts: 41396
Joined: Thu Aug 01, 2013 5:21 am

PreviousNext

Return to Health

Who is online

Users browsing this forum: No registered users and 35 guests