U.S. government gave $3.7 million grant to Wuhan lab at cent

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 10:56 pm

Months after infection, many COVID-19 patients can't shake illness
by American Heart Association News
July 6, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


It was a Tuesday in late March when Julia Henry first felt the body aches and dry cough that signaled the start of her bout with COVID-19. By that weekend, her husband and three children also were sick. But the kids were fine less than a week later, her husband within two weeks.

"My husband just woke up one day starting to feel back to normal, and I kept waiting for that day when I would have that feeling. But I never did. I never did," said Henry, a 40-year-old physical therapist from New Hampshire.

"For more than two months, I couldn't do much of anything," she said. "Now after three months, I'm finally starting to be able to do some normal, everyday things, like play with my kids or cook dinner for my family."

As of early July 6, there have been nearly 2.9 million confirmed cases of COVID-19 in the United States, according to Johns Hopkins University's oft-used tracker. Of those, 906,763 – about 31% – are listed as "recovered." But recovery isn't the same for everyone. The World Health Organization reports the median time for recovery is up to two weeks for those with mild cases, while those with more severe cases can take up to six weeks for symptoms to resolve.

Some people, however, say they continue to experience symptoms months after infection. In doctor visits and on social media groups, a growing number of patients report lingering symptoms ranging from mild issues, such as continued loss of taste or smell, to more serious ones, such as heart palpitations, chest pain, shortness of breath, extreme fatigue, cognitive difficulties or recurring fevers.
Whether these symptoms eventually resolve or whether they signal permanent damage from the virus remains unknown.

"It has been just six months since the virus was detected in China, so nobody can tell you for sure if these are short-term or long-term complications," said Dr. Samer Kottiech, a cardiologist in New York City who estimates 90% of his patients who come in after COVID-19 infections experience prolonged symptoms.

Kottiech, who was himself infected in March, said he hasn't fully recovered either.

"The biggest problem is that my lung capacity is still a little bit decreased," he said. "I used to be very active. Now I don't feel like I can exercise like I used to."


With little data to go on, it is too soon to draw conclusions about what's happening to those with lingering issues, said Dr. Avindra Nath, head of clinical neurology at the National Institutes of Health's Institute for Neurological Disorders and Stroke.

He believes several things could be occurring: the patient could have an underlying condition, such as heart disease or diabetes, which they didn't know was there prior to infection; the virus, or the body's immune system response to it, could be causing new damage; or, the patient may be experiencing something called post-viral fatigue syndrome, a condition reported in some patients infected with other coronaviruses, such as SARS and MERS.

"What we know from these other viral infections is that they can cause problems that last for years," Nath said.


Nath is preparing to enroll patients in a study that will investigate what's going on in the immune systems of people who don't fully recover from COVID-19.

"There is some abnormality in the immune system that's doing it," he said. "We want to find out what those abnormalities are. Once you figure that out, you can potentially treat them."

Unlike trying to unravel what's happened to the immune systems of patients who have felt ill for years, Nath said, "we now have an excellent opportunity, because we know what these patients had and exactly when they had it. It is early enough in the course of this illness that we can learn a lot about how and why these symptoms are occurring, which could have broad implications for all people with post-viral syndrome."

However, people with lingering COVID-19 symptoms shouldn't assume they'll stay ill for years, Nath said. "I want to reassure people there is still time for them to get better. Even if they are only gradually improving, if they are getting better at all, they will probably continue to do so."

Editor's note: Because of the rapidly evolving events surrounding the coronavirus, the facts and advice presented in this story may have changed since publication. Visit Heart.org for the latest coverage, and check with the Centers for Disease Control and Prevention and local health officials for the most recent guidance.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Tue Jul 28, 2020 11:02 pm

Coronavirus symptoms: Mysterious, scary symptoms persist long after initial COVID-19 infection
by Chuck Goudie and Barb Markoff, Christine Tressel and Ross Weidner
ABC News
Monday, July 27, 2020 8:38PM

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.

Summary of Survey Findings:

• Long Haulers’ COVID-19 symptoms are far more numerous than what is currently listed on the CDC’s website
• While the impact of COVID-19 on the lungs and vascular system have received some media and medical attention, the results of this survey suggest that brain, whole body, eye, and skin symptoms are also frequent-occurring health problems for people recovering from COVID-19
• Survivor Corp group members frequently report reaching out to primary care doctors for help managing such lesser-known and painful symptoms, but find that some physicians are unable or unwilling to help patients manage these due to lack of research
• A reported 26.5% of symptoms experienced by Long Haulers are described as painful by the group members...

The 50 Most Common Long Hauler Symptoms: Fatigue; Muscle or body aches; shortness of breath or difficulty breathing; difficulty concentrating or focusing; inability to exercise or be active; headache; difficulty sleeping; anxiety; memory problems; dizziness; persistent chest pain or pressure; cough; joint pain; heart palpitations; diarrhea; sore throat; night sweats; partial or complete loss of sense of smell; tacycardia; fever or chills; hair loss; blurry vision; gonested or runny nose; sadness; neuropathy in feet and hands; reflux or heartburn; changing symptoms; partial or complete loss of sense of taste; phlegm in back of throat; abdominal pain; lower back pain; shortness of breath or exhaustion from bending over; nausea or vomiting; weight gain; clogged ears; dry eyes; calf cramps; tremors or shakiness; sleeping more than normal; upper back pain; floaters or flashes of light in vision; rash; constant thirst; nerve sensations; tinnitus or humming in ears; changed sense of taste; sharp or sudden chest pain; confusion; muscle twitching; feeling irritable.

-- COVID-19 “Long Hauler” Symptoms Survey Report: A Study Conducted by Dr. Natalie Lambert and Survivor Corps, 7/25/2020

Thousands of patients are suffering from a range of scary and bewildering symptoms long after their initial bout with COVId19 is over.

CHICAGO (WLS) -- Across the globe people are reporting persistent, mysterious and frightening symptoms for weeks and months after becoming infected with COVID-19.

Patients with severe disease would be expected to suffer from long-lasting consequences. But the ABC7 I-Team found a growing number of younger people, even those with a milder form of the virus, are experiencing bizarre and frightening long-term symptoms. They have become known as the "long haulers."

Medical experts and researchers are now scrambling to find the triggers and best treatments for those who can't seem to get better from this post-viral syndrome.

The unusual symptoms include brain fog, loss of sense or smell, headaches, fevers and chronic fatigue. Some of the more severe ailments being reported are spiking blood pressure, racing heart beats and blood clots.


Elizabeth Moore from Northwest Indiana is one of those patients. Months after getting over COVID-19 she started having frightening, unexplained symptoms.

"I could feel it in my body out of nowhere, this sort of buzzing, rushing sensation, tingling in my arms, especially in my left but it was on both sides," she said.

The 43-year-old wife, mother and lawyer said she never had medical issues until now.

She said she would try to sleep, but the tingling sensation would jolt her awake and leave her gasping for air. Moore said it would feel as if someone was pouring ice cold water down her back. Her heart would race and her blood pressure would spike to dangerous levels.

"I truly thought I had a heart attack or a stroke, like that's what it felt like to me. It was terrifying," she said.

Moore said she's also suffering from symptoms ranging from extreme fatigue, brain fog and, most recently, intense gastrointestinal issues.

She's been to the emergency room twice with no resolutions. One doctor told her she might just be suffering from gastroesophageal reflux disease or GERD.


Moore and other frustrated patients are joining online forums and social media sites to find support, validation and answers.

Diana Berrent is the founder of one such site, called Survivor Corps.

"Over and over and over again, people are being turned away by their doctors, being given diagnoses of anxiety. And when their lab reports are saying nothing of the kind," she said.

Survivor Corps is a grassroots organization with an estimated 80,000 members on Facebook.

Berrent, a New York photographer, started the non-profit after posting about her own COVID-19 journey. She discovered there were many people who were feeling anxious and alone as they were dealing with the virus.

She said the group's core mission is to connect the survivor community with the opportunity to donate plasma and support scientific research related to COVID-19.

"We have sort of unintentionally created the world's greatest data set on survivors, that is being recorded in real time," she said.

Results of a survey conducted by the group and analyzed by researcher Natalie Lambert at the Indiana University Medical School was just released. It finds "long hauler" symptoms are far more numerous than what is currently listed on the CDC's website. The Survivor Corps list is extensive.

"Doing these sorts of analysis projects, this is just the first of many that we will be putting out and disseminating. We are an open source from beginning to end, so we will be disseminating this to the entire medical community. We want doctors to be aware of this, we want patients to be aware of this, it will be available for everybody to download on our website," said Berrent.

With so many unknowns about a virus only discovered about seven months ago, some researchers said they are open to crowdsourced information and collaboration.

The CDC just acknowledged in a new report that one-third of COVID-19 patients who were not hospitalized may experience long term symptoms weeks after their initial illness.

Earlier in July a study in JAMA Network analyzed a little over 140 patients in Italy. It found nearly 90% of patients who recovered from COVID-19 reported some kind of lingering symptom, including breathing issues and fatigue.

"The virus should not be taken lightly, it's causing a lot of damage in multiple different organ systems. And so, it's not surprising that people have symptoms that persist for extended periods," said Dr. Avindra Nath, Clinical Director of the National Institutes of Neurological Disorders and Stroke.


He said it is too early to reach any conclusions, including whether the lingering issues will be permanent.

Nath is launching several studies at the National Institutes of Health to look at the immune systems of patients and study the neurological complications of the virus.

"We're going to try to figure out how much of that may be coming from a deranged immune system and how much of that may be coming through persistent viral infection," he said.

In Chicago, the Neuro COVID-19 Clinic at Northwestern Memorial Hospital is one of only a handful of medical centers dedicated to studying and treating these long term effects.

Dr. Igor Koralnik, chief of Infectious Diseases and Global Neurology at Northwestern Medicine, said the virus can start an inflammatory response in the body that can lead to a multitude of different symptoms.

He said other causes can be a direct invasion of the nervous system by the virus or a post-infectious autoimmune manifestation.


Koralnik said the clinic is providing care for patients who experience side effects and is also studying the long-term effects COVID-19 can have on the brain, nervous system and muscles.

"And so we are learning by following them over time, to see how long those complications are, and how to manage them In the meantime," he explained.

And, he added, "The COVID-19 Clinic is open to everyone from all over the US, and we can accommodate people in televisits or in-person visits as they prefer."

Moore discovered the clinic in a support group posting and just became a patient.

"Finding Northwestern was a relief, just to have, at least, someone besides being on a social media group, have a doctor say you're not crazy," she said.

She wants other patients who might be feeling hopeless to know that they are not alone.

"Now that we're starting to get, you know, doctors on board, who are willing to research and look into what's going on I think that's a really positive thing and you just need to keep moving in that direction," said Moore.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 4:24 am

Part 1 of 2

Did the SARS-CoV-2 virus arise from a bat coronavirus research program in a Chinese laboratory? Very possibly.
by Milton Leitenberg
Bulletin of the Atomic Scientists
June 4, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


Image
This scanning electron microscope image shows SARS-CoV-2 in yellow. This scanning electron microscope image shows SARS-CoV-2 in yellow. (Photo credit: Credit: NIAID-RML)

On May 15, the Bulletin of the Atomic Scientists published a short commentary titled, “Let evidence, not talk radio, determine whether the outbreak started in a lab,” by Ali Nouri, a biologist and president of the Federation of American Scientists. “The outbreak” referred to the pandemic of SARS-CoV-2 now circling the globe. It is a thin commentary, and it is puzzling why the Bulletin thought it desirable to publish it at all. Only two weeks earlier the journal had published a reasoned and competent appraisal by Kings College London biosecurity expert Filippa Lentzos titled, “Natural spillover or research lab leak? Why a credible investigation is needed to determine the origin of the coronavirus pandemic.”

The Nouri article very correctly pilloried the statements by President Donald Trump, Secretary of State Mike Pompeo, presidential legal advisor Rudy Giuliani, and radio personality Rush Limbaugh. These are as notorious a gang of four fabricators as will ever likely be recorded in American history. They were ably assisted by Fox News, which the Nouri critique also mentions. Nouri ended his commentary with these lines: “Our leaders ought to … take steps to prevent the next pandemic, instead of diverting our attention to unsupported sensationalist theories spread by cable TV and talk radio.”

Perhaps the most damaging blows to efforts to obtain a certain answer as to the origin of the SARS-CoV-2 “outbreak” have been the pronouncements by Trump, Pompeo, and their echo chambers. But they and their remarks are not the measure by which the question of the possibility that a laboratory escape began the pandemic should be examined. Trump’s diversionary ranting comes from a president who did nothing for two months in the face of an oncoming lethal pandemic, actively denied and denigrated intelligence warnings of the imminent danger, and said that SARS-CoV-2 would “just go away … like a miracle” and that “within a couple of days is going to be down close to zero.” All this has been widely and thoroughly chronicled.1

But long before Trump, Pompeo and Co. sought a Chinese scapegoat for the president’s gross and willful incompetence, researchers understood that the possibility of laboratory escape of the pathogen was a plausible, if unproven, possibility. It is most definitely not “a conspiracy theory.”


The circumstantial evidence for a lab escape.

By way of introduction, there are two virology institutes in Wuhan to consider, not one: The Wuhan Center for Disease Control and Prevention (WHCDC) and the Wuhan Institute of Virology (WIV). Both have conducted large projects on novel bat viruses and maintained large research collections of novel bat viruses, and at least the WIV possessed the virus that is the most closely related known virus in the world to the outbreak virus, bat virus RaTG13. This virus was isolated in 2013 and had its genome published on January 23, 2020. Seven more years of bat coronavirus collection followed the 2013 RaTG13 isolation.

One component of the novel-bat-virus project at the Wuhan Institute of Virology involved infection of laboratory animals with bat viruses. Therefore, the possibility of a lab accident includes scenarios with direct transmission of a bat virus to a lab worker, scenarios with transmission of a bat virus to a laboratory animal and then to a lab worker, and scenarios involving improper disposal of laboratory animals or laboratory waste.


Image
A May 20, 2020, photo of the Wuhan Institute of Virology in Wuhan, where research on bat coronaviruses was conducted. (Photo by Kyodo News via Getty Images)

Documentary evidence indicates that the novel-bat-virus projects at Wuhan CDC and the Wuhan Institute of Virology used personal protective equipment and biosafety standards that would pose high risk of accidental infection of a lab worker upon contact with a virus having the transmission properties of the outbreak virus.

In assessing the possibility of a lab accident, one must take into consideration each of the following eight elements of circumstantial evidence:

1. Official Chinese government recognition early in the SARS-CoV-2 outbreak of biosafety inadequacies in China’s high containment facilities.


In February 2020, several weeks after the outbreak of the disease in Wuhan, China’s President Xi Jinping stressed the need to ensure “biosafety and biosecurity of the country.”2 This was followed immediately by a China Ministry of Science & Technology announcement of new guidelines for laboratories, especially in handling viruses.3 Almost at the same time, the Chinese newspaper Global Times published an article on “chronic inadequate management issues at laboratories, including problems of biological wastes.”4

A PBS NewHour presentation on May 22, 2020 provided the following information:

On January 1, Wuhan Institute of Virology’s director general, Yanyi Wang, messaged her colleagues, saying the National Health Commission told her the lab’s COVID-19 data shall not be published on social media and shall not be disclosed to the media. And on January 3, the commission sent this document, never posted online, but saved by researchers, telling labs to destroy COVID-19 samples or send them to the depository institutions designated by the state. Late Friday [May 16, 2020] the Chinese government admitted to the destruction … but said it was for public safety.


The Chinese government explanation for the destruction of SARS-CoV-2 samples has no scientific credibility. For purposes of “public safety” any samples would surely be stored and studied, exactly as with the ones that were isolated from patients, and their RNA genomes decoded and published.

2. Recognition by Zhengli Shi, a renowned scientist who leads a research team at the Wuhan Institute of Virology, that a laboratory escape was a possibility.

Shi took the possibility of a laboratory escape perfectly seriously. Jonna Mazat of the University of California-Davis, a collaborator with Dr Shi, told Josh Rogin of the Washington Post, “Absolutely, accidents can happen.” In an interview with Scientific American, Shi admitted that her very first thought was “If coronaviruses were the culprit, she remembers thinking ‘Could they have come from our lab?’”

Meanwhile she frantically went through her own lab’s records from the past few years to check for any mishandling of experimental materials, especially during disposal. She breathed a sigh of relief when the results came back: none of the sequences matched those of the viruses her team had sampled from bat caves. ‘That really took a load off my mind,’ she says. ‘I had not slept a wink for days.’


3. Questions surrounding Chinese government attribution of the Wuhan’s Huanan South China Seafood Market as the source of the SARS-CoV-2 virus.

Many China scholars noted that it was quite unusual for Chinese government authorities to identify Wuhan’s Huanan South China Seafood Market so quickly as the source of the outbreak. They thought this behavior so uncharacteristic that it raised suspicions in their minds. The authors of a newly published paper wrote that

…we were surprised to find that SARS-CoV-2 resembles SARS-CoV in the late phase of the 2003 epidemic after SARS-CoV had developed several advantageous adaptations for human transmission. Our observations suggest that by the time SARS-CoV-2 was first detected in late 2019, it was already pre-adapted to human transmission to an extent similar to late epidemic SARS-CoV. However, no precursors or branches of evolution stemming from a less human-adapted SARS-CoV-2-like virus have been detected…. It would be curious if no precursor or branches of SARS-CoV-2 evolution are discovered in humans or animals….Even the possibility that a non-genetically-engineered precursor could have adapted to humans while being studied in a laboratory should be considered, regardless of how likely or unlikely.5


It is important to note that no intermediary host has yet been identified for the SARS-CoV-2 virus. The authors also noted that “[n]o animal sampling prior to the shutdown and sanitization [of the Wuhan fish market] was done.”

Image

The question of whether the index case appeared in the Wuhan fish market appears to be moot in any case. Chinese researchers have published data showing that there were 41 cases of SARS-CoV-2 between December 1, 2019 and January 2, 2020. Fourteen of these had no contact with the Huanan seafood market, including the very first recorded case on December 1, 2019.6 And that supposes that the true index case was December 1, which is doubtful.

On May 26, the Chinese government scrapped the previous official story about the Wuhan fish market:


China’s top epidemiologist said Tuesday that testing of samples from a Wuhan food market, initially suspected as a path for the virus’s spread to humans, failed to show links between animals being sold there and the pathogen. Gao Fu, director of the Chinese Center for Disease Control and Prevention, said in comments carried in China state media.7


No SARS-CoV-2 isolates were detected in any of the animals or fish sold at the market, only in environmental samples, including sewage. Gao Fu added, “At first, we assumed the seafood market might have the virus, but now the market is more like a victim. The novel coronavirus had existed long before.”8

4. Suppression of information and individuals by Chinese authorities.

A publication by two Chinese university academics discussed both the WHCDC and the WIV and concluded that “the killer coronavirus probably originated from a laboratory in Wuhan”; the publication was removed from the internet by Chinese government officials. The paper had been posted on Research Gate but was blocked after 24 hours. After being placed on an archive file by internet users, it was again blocked after a week, and the two Chinese authors were pressured to retract the paper. However, it is still available on Web archives.9

The Chinese government closed the laboratory in Shanghai that first published the genome of COVID-19 on January 10, explaining that it had been shuttered for “rectification”; the closure happened on January 11. The government then permitted the same genome to be published by Shi on January 12.10 Chinese citizens who reported on the coronavirus were censured and, in some cases, “disappeared.”11 These have included businessman Fang Bin, ...

Fang Bin (Chinese: 方斌) is a Chinese businessman, citizen journalist and whistleblower who used Youtube and WeChat to broadcast images of Wuhan during the COVID-19 pandemic. He was arrested several times between February 1 and 9, 2020. He has been missing since his arrest on February 9, 2020...

On February 1, 2020, Fang released a new video showing the piling up of corpses at the back of a minivan in front of a Wuhan hospital. The video was shared on Twitter by Chinese journalist Jennifer Zeng. Fang was arrested on the same day, warned and eventually released during the night.

In February 2020, Fang and two other citizen journalists and whistleblowers, Chen Qiushi and Li Zehua, were arrested and went missing in Wuhan. Chen, a lawyer who arrived in Wuhan on January 23, disappeared first on February 6; one week prior, he had uploaded a video criticising the Chinese government's manipulation of information which ended with the sentence "I am not afraid to die! You think I am afraid of you communist party?". Li, another citizen journalist, went missing in late February, but reappeared in April posting a neutral, patriotic video, in contrast to his previous tone.

Two days before Chen's arrest, on February 4, the police came twice to Fang's apartment. He recorded the scene and refused to let them in without a warrant, worried that they had come in large numbers to arrest him (he counted at least four officers). Fang kept making videos from his apartment during the following days, criticising the government's propaganda and its choice to arrest Chen and Li Wenliang. On February 9, he released his last video: a 12-second clip showing a piece of paper with the sentence "resist all citizens, hand the power of the government back to the people" written on it. He has been missing ever since.

-- Fang Bin, by Wikipedia


lawyer Chen Qiushi,...

Chen Qiushi; born September 1985) is a Chinese lawyer, activist, and citizen journalist who covered the 2019–20 Hong Kong protests and the COVID-19 pandemic which included criticism of the government response. He was last heard from on 6 February 2020; as of July 2020, his whereabouts remain unknown. The Chinese government reportedly informed Chen's family and friends that he has been detained for the purpose of COVID-19 quarantine. Critics, including media freedom groups, have expressed skepticism about government motives, and have unsuccessfully called on the government to allow outside contact with Chen...

Chen began reporting on the COVID-19 pandemic in China, travelling to Hankou, Wuhan, on 23 or 24 January 2020, where he interviewed the locals and visited various hospitals including Huoshenshan Hospital, which was still under construction at the time. According to Chen, doctors were overworked and there were insufficient medical supplies, but prices of goods were otherwise stable. Chen published a video on 30 January showing the crowding in Wuhan hospitals, with many people lying in corridors. Unlike state media reporters who had hazmat suits, Chen appeared to have only goggles and a face mask to protect himself. Chen stated, "I am afraid. In front of me is disease. Behind me is China's legal and administrative power. But as long as I am alive I will speak about what I have seen and what I have heard. I am not afraid of dying. Why should I be afraid of you, Communist Party?— Chen Qiushi, 30 January 2020."

By early February 2020, while reporting about the coronavirus outbreak, Chen had 433,000 YouTube subscribers and 246,000 Twitter followers. Chen's supporters accused the Chinese government of censorship of the coronavirus outbreak. According to The Guardian, many pro-Chen comments on Sina Weibo were censored. Around 4 February, in the last video posted by Chen before his subsequent disappearance, Chen interviewed Wuhan resident "A Ming". A Ming stated his father had probably contracted coronavirus during a health check-up in the beginning of January, when there were no safety precautions; A Ming's father had subsequently died from the virus. During the video Chen stated "many people are worried I will be detained"...

Chen disappeared on 6 February 2020, at some point after informing his family of an intention to report on a temporary hospital. His friends were unable to contact him after 7 pm UTC+8 on 6 February. His mother, and friend Xu Xiaodong, have both stated that on 7 February, they received news from authorities that Chen had been detained at an undeclared time and place and held in an unknown location for the purpose of quarantine...

Around March 2020 it was reported that Li Zehua, a citizen journalist in part inspired by Chen, had also disappeared...

On 23 March, the Chinese Ambassador to the US, Cui Tiankai, stated he'd never heard of Chen... Li Zehua resurfaced in April 2020, stating he had been released on 28 March from a quarantine.-- Chen Qiushi, by Wikipedia


former state TV reporter Li Zehua ...

Li Zehua... is a Chinese citizen journalist, rapper and YouTuber... After graduating from Communication University of China, he joined China Central Television (CCTV) as a television presenter in 2016.

During the COVID-19 pandemic in China, he resigned from CCTV and found a way to get into Wuhan, hoping to trace disappeared journalist Chen Qiushi. With the help of locals, he was able to get a car and find a place to stay. In the following days, he used a vlog to report on the pandemic in Wuhan. He disappeared on 26 February 2020, presumed detained by officers from state security. Parts of his chase with the Wuhan authorities was caught on video and uploaded to YouTube. It was reported that Li Zehua returned to the hotel on 28 February. However, other reports stated that no one has heard from Li since his 26 February 2020 disappearance.

On 22 April 2020, Li posted a video on Youtube, Twitter, and Weibo, and uploaded the English subtitle to YouTube in the following days. According to Li, he was escorted on 26 February to the police station and was under investigation for disrupting public order. Additionally, police detained and quarantined him, citing his visits to sensitive epidemic areas. Li's quarantine was at first in Wuhan, and later moved to his hometown. Li stated that he had been treated well by the police during the detention, and that he had been released on 28 March...

At the end of his April 22 post, he quoted the Book of Documents aphorism "the mind of man is restless, prone (to err); its affinity to what is right is small. Be discriminating, be uniform (in the pursuit of what is right), that you may sincerely hold fast the Mean."... and gave his own interpretation in English:

The will of the people is unpredictable, the heart of Tao (the essence of cosmos) is fathomless. In order to make the will of the people consistent with the heart of Tao and reach the state of Unity of people and cosmos [zh], only the way is concentrate all energy on cultivation of the good nature of the heart, do not act in extreme, do not change faith, do not be fickle, uphold the doctrine of the golden mean of Confucian orthodoxy.

-- Li Zehua, by Wikipedia


and, most recently, Zhang Zhan, a lawyer.

A "citizen journalist" who has reported on the coronavirus emergency in Wuhan (Hubei), the epicenter of the pandemic, has been detained in a prison in Shanghai, the city where she resides, since February.

Zhang Zhan had disappeared on May 13, after live YouTube streaming from Hankou train station square. According to some of her friends, she was arrested on May 15 for "disturbing social stability and creating problems of public order".

In her stories, posted on YouTube, Twitter and other social media, the 37-year-old often attacked the Chinese government, whom she reputed at fault in having inadequately managed the crisis and depriving the Chinese people of their fundamental rights. In a February 16 Twitter post, Zhang accuses the authorities of lying about the actual number of Covid-19 victims to maintain stability.

During her stay in Wuhan, she also provided legal assistance to Yang Min, a woman who had asked for justice for her daughter who died of coronavirus, and therefore was placed under house arrest. Zhang had been arrested as early as September in Shanghai: she spent 60 days in prison for demonstrating in favor of Hong Kong's pro-democracy demonstrators.

Three other "citizen journalists" disappeared in Wuhan in February. Li Zehua, who had talked about the crematoriums of the city open 19 hours a day, reappeared on April 22 after a period under arrest. However, there is no news of Fang Bin and Chen Qiushi...

Since mid-March there has been no news of Ai Fen, the Wuhan doctor who raised the alarm on the disease. In the same days, Ren Zhiqiang, a billionaire who was already a member of the Chinese Communist Party (CCP), was also targeted for referring to President Xi Jinping as a "power hungry clown".

Since February there has been no news even of Xu Zhangrun and He Weifang. The two intellectuals had criticized the regime, arguing that the lack of press freedom has favored the spread of the coronavirus. A Shandong university student, Zhang Wenbin, disappeared on March 30 after posting a video asking for Xi to resign.

Chen Zhaozhi, a retired professor at Beijing University of Science and Technology, was imprisoned in Beijing on April 14. He said that Covid-19 is not a "Chinese virus", but a "Chinese Communist Party virus", linking the origin and spread of the lung disease to the regime.

-- Zhang Zhan, a 'journalist citizen' who disappeared in Wuhan, arrested, by AsiaNews.it


They are reportedly being held in extrajudicial detention centers for speaking out about China’s response to the pandemic. They are usually accused of “picking quarrels and provoking trouble.”12

Another aspect of Chinese government secrecy involved in the SARS-CoV-2 pandemic relates to official reporting by Chinese government officials on the severity of the outbreak in China and on levels of mortality. The number of cases and deaths are suspected of being undercounted by at least an order of magnitude, and possibly two, meaning that the reported figures could be as little as one percent of the actual totals. In the last week of April 2020, Caixin, one of the most reliable publications in China, reported that a serological study had been carried out in Wuhan on 11,000 inhabitants. Extrapolating from its results, which showed that five to six percent of the sample of 11,000 persons carried antibodies for SARS-CoV-2, Caixin estimated that 500,000 people in the city had been infected, or 10 times the level of official Chinese government reporting. The publication was quickly deleted by Chinese government censors.13

The Chinese government has also attempted to obscure the origins of the pandemic with disinformation. On March 13, Chinese Foreign Ministry spokesperson Zhao Lijian suggested that the United States might have introduced the coronavirus to Wuhan.14


The US National Institutes of Health (NIH) funded bat-coronavirus research in the Wuhan Institute of Virology in China to the tune of US $3.7 million, a recent article in the British newspaper Daily Mail revealed.

Back in October 2014, the US government had placed a federal moratorium on gain-of-function (GOF) research -– altering natural pathogens to make them more deadly and infectious -– as a result of rising fears about a possible pandemic caused by an accidental or deliberate release of these genetically engineered monster germs.

This was in part due to lab accidents at the US Centers for Disease Control and Prevention (CDC) in July 2014 that raised questions about biosafety at US high-containment labs.

At that time, the CDC had closed two labs and halted some biological shipments in the wake of several incidents in which highly pathogenic microbes were mishandled by US government laboratories: an accidental shipment of live anthrax, the discovery of forgotten live smallpox samples and a newly revealed incident in which a dangerous influenza strain was accidentally shipped from the CDC to another lab.

A CDC internal report described how scientists failed to follow proper procedures to ensure samples were inactivated before they left the lab, and also found “multiple other problems” with operating procedures in the anthrax lab.

As such in October 2014, because of public health concerns, the US government banned all federal funding on efforts to weaponize three viruses –- influenza, Middle East respiratory syndrome (MERS) and severe acute respiratory syndrome (SARS).

In the face of a moratorium in the US, Dr Anthony Fauci –- the director of the National Institute of Allergy and Infectious Diseases (NIAID) and currently the leading doctor in the US Coronavirus Task Force –- outsourced in 2015 the GOF research to China’s Wuhan lab and licensed the lab to continue receiving US government funding...

Nonetheless, it is unclear what the legal ramifications would be if the virus was indeed leaked from a Chinese lab, but as a result of a research project that was outsourced and funded by the US government.

Also, if there was a government ban in 2014 on federal funding being used for GOF research, what are the federal compliance and ethical issues surrounding the fact that the NIH still gave federal funding instead of private funding to the Wuhan lab to continue the experiments?

Moreover, could some strains of the coronavirus have originated in U.S. labs, given the fact the US government lifted the ban in December 2017 on GOF research without resolving lab-safety issues?


-- Why US outsourced bat virus research to Wuhan: US-funded $3.7 million project approved by Trump's Covid-19 guru Dr Anthony Fauci in 2015 after US ban imposed on 'monster-germ' research, by Christina Lin


A month later, Zhao Lijian again posted Russian coronavirus and biowarfare-related disinformation, this time followed by online posts from Chinese ambassadors in 13 countries spread across the world.15

Meanwhile Chinese government officials have promoted baseless conspiracy theories about the virus’s origins, claiming that the United States military brought it to Wuhan. Zhao Lijian, a spokesperson for the Chinese Ministry of Foreign Affairs, retweeted one such article from the fringe conspiracy website Global Research.

-- Analyzing China’s Coronavirus Propaganda Messaging in Europe, by Matt Schrader


This was unprecedented diplomatic behavior for China, but not an accident. It was a concerted, deliberate, and preposterous disinformation campaign, repeated in May by CGTN, the China Global Television Network, which reposted the disinformation to the social media sites Weibo, Facebook, and Twitter.16 The history of Soviet and then Russian government biowarfare disinformation suggests that a country spreading such disinformation has or may have something to hide.17

You know Ralph, I think the public has not been in on this debate. It has been a secret debate with the NIH and other people who funded it. I think COVID-19 is a product of this. And I know Trump wants to call it the China virus. Well, the money that went into the creation and the genetic engineering of these coronaviruses in Wuhan was supported by the NIH and the USAID. So why wouldn't it be the NIH virus, or the USAID virus?

-- Interview with Andrew Kimball on the Ralph Nader Radio Show, Ralph Nader Radio Hour Episode 332


5. Laboratory accidents and the escape of highly dangerous pathogens from laboratories are frequent occurrences worldwide.

The accidental infection of researchers in the highest containment biosafety facilities—labelled BSL-2, BSL-3 and BSL-4—occurs worldwide, as do accidental releases by other means. In an excellent review published in February 2019, Lynn Klotz of the Center for Arms Control and Non-Proliferation noted that three releases of Ebola and Marburg viruses from BSL-4 and lower-containment facilities in the United States had occurred due to incomplete inactivation of cultures. Releases via infection of researchers took place in the highest containment facilities in the United States—at the Centers for Disease Control and Prevention (CDC) in Atlanta and at the US Army Medical Research Institute of Infectious Diseases (USAMRIID)—but in all cases only the researcher became ill, and there was no further transmission of the pathogen.

“In an analysis circulated at the 2017 meeting for the Biological Weapons Convention, a conservative estimate shows that the probability is about 20 percent for a release of a mammalian-airborne-transmissible, highly pathogenic avian influenza virus into the community from at least one of 10 labs over a 10-year period of developing and researching this type of pathogen,” Klotz wrote. “This percentage was calculated from FSAP [US Federal Select Agent Program] data for the years 2004 through 2010. Analysis of the FOIA NIH (National Institutes of Health) data gives a much higher release probability—that is, a factor five to 10 times higher, based on a smaller number of incident reports.”18


Between 2009 and 2015, the FSAP recorded 749 incidents in seven categories—not solely releases or researcher infections—from 276 facilities. In addition, Klotz recorded 11 confirmed releases of select agents that resulted in a laboratory-acquired infection in roughly 280 specifically approved laboratories in the United States between 2003 and 2017, a rate of just under one per year.19 A second publication in the Bulletin that covered closely-related subject matter and a personal communication from its author suggested that federally reported cases involving select agents were likely to be substantially undercounted:20

There is a fundamental problem of using the defined select agents as a surrogate for potential pandemic agent releases from research labs. The vast majority of ‘classical BW agents’ that initially defined select agents in the US were selected specifically to be NOT capable of sustained transmission so as to better define the military tactical limits of a military employment and because the establishment of progressive transmission was considered unpredictable and possibly counterproductive in military operations, at least on the US side of offensive development in the 1940s-1960s.

As my historical review of lab escapes that resulted in pandemics or wide area epidemics published in the BAS found, most pandemic, continental or large scale community outbreaks originating from lab escapes came from civilian labs working with public or veterinary pathogens of non-military interest.

It takes only one superspreading graduate student or maintenance worker to start a pandemic.


It is known that a very large percentage of the individuals infected with the SARS-CoV-2 virus show no symptoms and do not become clinically ill, which would facilitate an unrecognized infection of one or more laboratory researchers.

6. There have been laboratory accidents and escapes of highly dangerous pathogens in China in general and biosafety issues at the Wuhan Institute of Virology in particular.

After the SARS epidemic in 2002-2003, which originated naturally in China and which China initially kept secret, work on the coronavirus pathogen that was responsible for the outbreak was undertaken in laboratories around the world. This research led to six cases of infection in laboratory workers: four in the National Institute of Virology in Beijing and one each in laboratories in Singapore and Taiwan.

The laboratory-acquired infections of lab workers in Beijing led to short-lived outbreaks of SARS in the Beijing region in 2004.21

A second case of infected researchers in China resulted in brief outbreaks of disease in early December 2019. An outbreak of brucellosis began in an agricultural laboratory in Lanzhou (Gansu Province, central China) and spread to China’s premier bird flu laboratory in Harbin (Heilongjiang Province, northeast China). It was linked to index cases involving graduate students who were exposed while conducting research and included at least 96 people.22


7. Under what biosafety conditions was bat coronavirus research carried out at the Wuhan Institute of Virology?

Most work—including all published work using live bat coronaviruses that were not SARS-CoV and MERS-CoV—was conducted under BSL-2 conditions.23 This was consistent with both WHO and CDC recommendations.24 BSL-2 provides only minimal protection against infection of laboratory researchers, and these regulations were almost certainly too lenient for working with bat coronaviruses. All such work should have been carried out under BSL-3 conditions. However, extremely high-risk gain of function (GoF) studies with bat SARS-related coronaviruses were carried out at BSL-3 or BSL-4. Statements made by various commentators claiming that the WIV worked only with RNA isolates and not with live viruses are untrue (as discussed in further detail in a following section).
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 4:25 am

Part 2 of 2

In regard to the Wuhan Institute of Virology in particular, relevant information is again available from both Chinese and Western sources. Information from official Chinese government sources appeared in a Voice of America report which noted:

[T]here is Chinese evidence that the lab had safety problems. VOA has located state media reports showing that there were security incidents flagged by national inspections as well as reported accidents that occurred when workers were trying to catch bats for study.

About a year before the corona virus outbreak, a security review conducted by a Chinese national team found the lab did not meet national standards in five categories.


The document on the lab’s official website said after a rigorous and meticulous review, the team gave a high evaluation of the lab’s overall safety management. “At the same time, the review team also put forward further rectification opinions on the five non-conformities and two observations found during the review.”
In addition to problems in the lab, state media also reported that national reviewers found scientists were sloppy when they were handling bats.

One of the researchers working at the Wuhan Center for Disease Control & Prevention described to China’s state media that he was once attacked by bats, and he ended up getting bat blood on his skin.

In another incident, the same researcher forgot to take protective measures, and the urine of a bat dripped “like rain onto the top of his head,” reported China’s Xinhua state news agent.
25


Also, information was leaked from the US Department of State and published in the Washington Post on April 14:

Two years before the novel coronavirus pandemic upended the world, U.S. Embassy officials visited a Chinese research facility in the city of Wuhan several times and sent two official warnings back to Washington about inadequate safety at the lab, which was conducting risky studies on corona viruses from bats. The cables have fueled discussions inside the U.S. government about whether this or another Wuhan lab was the source of the virus -– even though conclusive proof has yet to emerge.

In January 2018, the U.S. Embassy in Beijing took the unusual step of repeatedly sending U.S. science diplomats to the Wuhan Institute of Virology, which had in 2015 become China’s first laboratory to achieve the highest level of international bioresearch safety (known as BSL-4). WIV issued a news release in English about the last of these visits, which occurred on March 27, 2018. The U.S. delegation was led by Jamison Fouss, the consul general in Wuhan, and Rick Switzer, the embassy’s counselor of environment, science, technology and health. Last week, WIV erased that statement from its website, though it remains archived on the Internet.

What the U.S. officials learned during their visits concerned them so much that they dispatched two diplomatic cables categorized as Sensitive But Unclassified back to Washington. The cables warned about safety and management weaknesses at the WIV lab and proposed more attention and help. The first cable … also warns that the lab’s work on bat coronaviruses and their potential human transmission represented a risk of a new SARS-like pandemic.

“During interactions with scientists at the WIV laboratory, they noted the new lab has a serious shortage of appropriately trained technicians and investigators needed to safely operate this high-containment laboratory,”
states the Jan. 19, 2018, cable, which was drafted by two officials from the embassy’s environment, science and health sections who met with the WIV scientists.

[MATERIAL OMITTED AT THIS POINT BY AUTHOR MILTON LEITENBERG WHEN QUOTING THIS ARTICLE] (The State Department declined to comment on this and other details of the story.)

The Chinese researchers at WIV were receiving assistance from the Galveston National Laboratory at the University of Texas Medical Branch and other U.S. organizations, but the Chinese requested additional help. The cables argued that the United States should give the Wuhan lab further support, mainly because its research on bat coronaviruses was important but also dangerous.

As the cable noted, the U.S. visitors met with Shi Zhengli, the head of the research project, who had been publishing studies related to bat coronaviruses for many years. In November 2017, just before the U.S. officials’ visit, Shi’s team had published research showing that horseshoe bats they had collected from a cave in Yunnan province were very likely from the same bat population that spawned the SARS coronavirus in 2003.


“Most importantly,” the cable states, “the researchers also showed that various SARS-like coronaviruses can interact with ACE2, the human receptor identified for SARS-coronavirus. This finding strongly suggests that SARS-like coronaviruses from bats can be transmitted to humans to cause SARS-like diseases. From a public health perspective, this makes the continued surveillance of SARS-like coronaviruses in bats and study of the animal-human interface critical to future emerging coronavirus outbreak prediction and prevention.26


The US government had supplied a portion of the funds to build the Wuhan Institute of Virology and these cables were an appeal for funds to support additional training in biosafety and biosecurity. There were similar concerns about the nearby Wuhan Center for Disease Control and Prevention lab, which operates entirely at BSL-2. Chinese government authorities did not provide the US government with samples of the virus obtained from either the earliest cases or from the Wuhan fish market. A US intelligence official commented: “The idea that it was just a totally natural occurrence is circumstantial. The evidence it leaked from the lab is circumstantial. Right now, the ledger on the side of it leaking from the lab is packed with bullet points, and there’s almost nothing on the other side.”27

8. What is the nature of the research being carried out in Zhengli Shi’s laboratory at the Wuhan Institute of Virology?

Details of the most recent National Institute of Allergy and Infectious Diseases (NIAID) grant for WIV bat coronavirus surveillance and WIV bat coronavirus gain of function research are publicly available. The key activity for bat coronavirus surveillance is “Aim 1 … We will sequence receptor binding domains (spike proteins) to identify viruses with the highest potential for spillover which we will include in our experimental investigations (Aim 3).” The key activity for bat coronavirus gain of function investigation is “Aim 3…. We will use S protein sequence data, infectious clone technology, in vitro and in vivo infection experiments, and analysis of receptor binding to test the hypothesis that % divergence thresholds in S protein sequences predict spillover potential.”28

Translated into something approaching lay language, Aim 3 states that de novo synthesis is to be used to construct a series of novel chimeric viruses, comprising recombinant hybrids using different spike proteins from each of a series of unpublished natural coronaviruses in an otherwise-constant genome of a bat coronavirus. The ability of the resulting novel viruses to infect human cells in culture and to infect laboratory animals would be tested. The underlying hypothesis is that a direct correlation would be found between the receptor-binding affinity of the spike protein and the ability to infect human cells in culture and to infect laboratory animals. This hypothesis would be tested by asking whether novel viruses encoding spike proteins with the highest receptor-binding affinity have the highest ability to infect human cells in culture and laboratory animals.

The WIV began its gain of function research program for bat coronaviruses in 2015. Using a natural virus, institute researchers made “substitutions in its RNA coding to make it more transmissible. They took a piece of the original SARS virus and inserted a snippet from a SARS-like bat coronavirus, resulting in a virus that is capable of infecting human cells.”29 This meant it could be transmitted from experimental animal to experimental animal by aerosol transmission, which means that it could do the same for humans. In other words, gain of function techniques were used to turn bat coronaviruses into human pathogens capable of causing a global pandemic.


There have been three publications, in 2015,30 2016 and 2017, describing the WIV gain of function research. The WIV, having learned both basic and traceless infectious-clone technology from joint research with a laboratory at the University of North Carolina (UNC) in 2015, initiated construction of novel chimeric coronaviruses without UNC immediately thereafter. WIV’s first publication on the use of basic infectious-clone technology to construct novel chimeric coronaviruses at WIV appeared in 2016.31 WIV’s first publication on the use of traceless, signature-free infectious-clone technology also appeared in 2016.32

As this article was being edited, two excellent publications appeared that provide greater technical detail on WIV’s gain of function research, and readers should certainly examine these with care.33 The two papers strongly support the argument that the SARS-CoV-2 outbreak was the results of an escape from one of the two Chinese virology laboratories in Wuhan.

The Chinese government has proudly stated that the WIV “preserves more than 1,500 strains of virus,” the largest collection in Asia of bat and other coronaviruses.34 (The government statement probably should have said 1,500 isolates rather than “strains.”) The 2019 interview with Shi in Scientific American reports that the WIV had at least hundreds of individual strains.35 These numbers have been reported by Chinese government authorities, and they are being taken at face value here.

[O]n April 16th Peter Daszak, who is the President of the EcoHealth Alliance, told Democracy Now! in a lengthy interview that the lab escape thesis was “Pure baloney”. He told listeners:

“There was no viral isolate in the lab. There was no cultured virus that’s anything related to SARS coronavirus 2. So it’s just not possible...”

Daszak is the named principal investigator on multiple US grants that went to the Shi lab at WIV. He is also a co-author on numerous papers with Zheng-Li Shi, including the 2013 Nature paper announcing the isolation of coronavirus WIV-1 through passaging (Ge et al., 2013). One of his co-authorships is on the collecting paper in which his WIV colleagues placed the four fully functional bat coronaviruses into human cells containing the ACE2 receptor (Hu et al. 2017). That is, Daszak and Shi together are collaborators and co-responsible for most of the published high-risk collecting and experimentation at the WIV.

If the Shi lab has anything to hide, it is not only the Chinese Government that will be reluctant to see an impartial investigation proceed. Much of the work was funded by the US taxpayer, channeled there by Peter Daszak and the EcoHealth Alliance. Virtually every credible international organisation that might in principle carry out such an investigation, the WHO, the US CDC, the FAO, the US NIH, including the Gates Foundation, is either an advisor to, or a partner of, the EcoHealth Alliance. If the Sars-CoV-2 outbreak originated from the bat coronavirus work at the WIV then just about every major institution in the global public health community is implicated.

-- The Case Is Building That COVID-19 Had a Lab Origin, by Jonathan Latham, PhD and Allison Wilson, PhD


From 2004 on, the WIV published many dozens of partial or full genome sequences of coronaviruses in their collection. On June 1, Daszak and Shi published partial genetic sequences of 781 Chinese bat coronaviruses, more than one-third of which had never been published previously.36 There are also multiple published records of animal infection research with bat coronaviruses at the WIV. In order to carry out the research program described above, the WIV laboratory needs to use live viruses, and not just RNA fragments. This contradicts two of the assertions, made by some commentators, that Shi worked only with RNA fragments and that her laboratory did not maintain live viruses. On May 24, 2020, the director of the WIV acknowledged that the laboratory did have “three live strains of bat corona viruses on site,” but implied only three.37 Knowledgeable virologists assume that the number must be much higher, probably hundreds of live viral isolates.38

It is precisely in the course of the kind of gain of function research that the WIV conducted that there would be the greatest likelihood of infection of a laboratory researcher.
Many commentators have noted that millions of people in several western Chinese provinces, as well as in other South Asian countries, live their lives in daily proximity to bat caves and that serological testing has shown a fraction of these villagers to have antibodies to bat coronaviruses, showing that natural infection had occurred. The commentators argue therefore that “the odds” are in favor of SARS-CoV-2 having arisen in the field, and that a laboratory escape is so implausible that it is out of consideration. The logic of “the odds” is specious: It would take only a single laboratory infection to overcome “the odds,” if such could in fact be reckoned. That is essentially what happened in the four SARS laboratory infections that occurred in the Beijing laboratory in 2004; “the odds” for exposure of villagers in Yunnan province were irrelevant.

Since the SARS-CoV-2 genome was decoded and published, there have been numerous statements from virologists that the genome shows no indication of genetic manipulation, and that this too supports the argument that it arose in the field and did not escape from a laboratory. Although this argument implicitly recognizes that the WIV laboratory was using genetic engineering technology, there is no reason to arbitrarily assume that only a bat coronavirus that was genetically modified might have escaped from the laboratory. Nevertheless, the second portion of the NIAID research grant design made absolutely clear that the WIV would be applying genetic engineering techniques to bat coronaviruses. Using the current standard genetic engineering technology, many alterations of several bases in the RNA genome would be undetectable, including construction of a chimeric coronavirus encoding an unpublished spike protein in an unpublished genome. This would be the equivalent of a natural mutation in several bases that coded for the spike proteins.

An article in Independent Science News by Jonathan Latham and Allison Wilson discusses another mechanism, described by Nikolai Petrovsky of Flinders University in Australia, that could have resulted in the SARS-CoV-2 virus that produced the pandemic:

Take a bat coronavirus that is not infectious to humans, and force its selection by culturing it with cells that express human ACE2 receptor, such cells having been created many years ago to culture SARS coronaviruses and you can force the bat virus to adapt to infect human cells via mutations in its spike protein, which would have the effect of increasing the strength of its binding to human ACE2, and inevitably reducing the strength of its binding to bat ACE2.

Viruses in prolonged culture will also develop other random mutations that do not affect its function. The result of these experiments is a virus that is highly virulent in humans but is sufficiently different that it no longer resembles the original bat virus. Because the mutations are acquired randomly by selection there is no signature of a human gene jockey, but this is clearly a virus still created by human intervention.
39


Final comments.

On April 30 [April 27], Newsweek described a report produced by the US Defense Intelligence Agency which stated that “in early February, China’s Academy for Military Medical Sciences ‘concluded that it was impossible for them to scientifically determine whether the Covid-19 outbreak was caused naturally or accidentally from a laboratory incident.’” The author of a newly published paper analyzing the genome of SARS-COV-2 reported that “the COVID-19 virus is exquisitely adapted to infect humans… The virus’s ability to bind protein on human cells was far greater than its ability to bind the same protein in bats, which argues against bats being a direct source of the human virus.”40

The study, led by Flinders University scientists, compared the modeling to the virus's ability to bind to human cells and found the SARS-CoV-2 virus targets humans more potently than any of the tested animal species.

"The results clearly show that the COVID-19 virus is exquisitely adapted to infect humans," says Flinders University Professor Nikolai Petrovsky, lead author of a new paper just published online in arXiv, a leading US preprint server for researchers.

"The virus's ability to bind protein on human cells was far greater than its ability to bind the same protein in bats, which argues against bats being a direct source of the human virus."


The team's computer modeling shows the SARS-CoV-2 virus also bound strongly to cells of pangolins, an exotic ant-eater illegally imported into China.

"While it has been suggested by some Chinese scientists that the COVID-19 virus might have been transmitted to humans from pangolins, currently available data does not support this idea," Professor Petrovsky says...

The article, 'In silico comparison of spike protein-ACE2 binding affinities across species; significance for the possible origin of the SARS-CoV-2 virus' (2020) has been published on the arXiv pre-press server.

-- Origins of COVID-19 still a mystery, by Flinders University


Overall, the data indicates that SARS-CoV-2 is uniquely adapted to infect humans, raising important questions as to whether it arose in nature by a rare chance event or whether its origins might lie elsewhere.

Geng Shuang, a spokesman for the Chinese Ministry of Foreign Affairs, said. “China has mentioned many times that the origin of the virus is a scientific question, which should be evaluated by scientists and medical experts, and should not be politicized.”41 Essentially the same position on the possibility that a lab leak originated the pandemic was expressed by Xiao Qiang, a research scientist at the School of Information at the University of California, Berkeley. “I don’t think it is a conspiracy theory. I think it’s a legitimate question that needs to be investigated and answered. To understand exactly how this originated is critical knowledge for preventing this from happening in the future.”42

But Chinese officials reacted angrily in April when Australian officials suggested that the World Health Organization should be able to quickly investigate a disease outbreak that could lead to a pandemic, retaliating by instituting trade restrictions on several Australian agricultural exports to China. In early May, the World Health Organization’s representative in China, Gauden Galea, publicly complained that China had refused repeated requests to permit the WHO to participate in whatever investigations the Chinese government was undertaking itself. He said that the WHO had not been given access to laboratory logs at the WIV or the Wuhan Chinese Center for Disease Control and Prevention.43

On May 18, prior to a meeting of the WHO governing board, the European Union submitted a draft resolution supported by 100 nations that asked the WHO “to work with other United Nations agencies to ‘identify the zoonotic source of the virus and the route of introduction to the human population, including the possible role of intermediate hosts. … The document does not propose a review to identify missteps in how countries handled the outbreak and is instead forward-looking. It calls on the WHO to potentially arrange ‘scientific and collaborative field missions’ to help prevent similar future outbreaks. It also appears to rule out the possibility that the virus was man-made or experimented upon.”44

The draft resolution did not mention Wuhan or China.45


On May 18, China’s President Xi addressed the meeting of the governing body of the WHO via video. Ironically, Xi asked that countries “step up information sharing” but declared that China would support a review of the pandemic led by the WHO as long as it was “objective and impartial” and held after the pandemic was under control or over. The operative WHO resolution focuses on identifying “the zoonotic source of the virus” and says nothing about any forensic investigation.46 The Chinese Foreign Ministry spokesman Zhao Lijian declared that “China supported an international inquiry all along,” and China’s Global Times asked: “Will China oppose scientific research into the virus’ origin? No, because it is a necessary move to fight COVID-19 in a scientific way and conducive to prevention measures and development of vaccines and medicine,” but added “Not only China-related factors but also those related to the US and other countries need to be included. Earlier confirmed cases than the previously known first infected case have continuously been found in the US. Among those diagnosed as having flu last winter, how many were coronavirus infections? All these clues shouldn’t be missed.”47

What does this all mean at the present time? We have in China:

• a record of laboratory escape of the SARS virus in 2004 from a premier Chinese research institute.
• a record of poor biosafety in some of its high-containment facilities, including in the Wuhan institutes.
• a record of suppression of information in general, and in the case of SARS-CoV-2 in particular.
• the initiation of a disinformation campaign in regard to the origin of SARS-CoV-2, targeting US biological laboratories.
• a record of gain of function research at the Wuhan Institute of Virology, including passage of a bat coronavirus construct through experimental animals.

Writing in the Bulletin of the Atomic Scientists before the WHO governing board was convened, Filippa Lentzos advocated for a forensic investigation and described what it would entail:

Investigating the range of possible spillover sites—from the wet market, to an accidental lab or fieldwork infection, or an unnoticed lab leak—requires a forensic investigation. Obtaining case histories, epidemiological data, and viral samples from different times and places, including the earliest possible samples from infected individuals and samples from wildlife, is paramount… A forensic investigation would additionally involve auditing and sampling viral collections at relevant labs that had been studying coronaviruses, examining the types of experiments carried out and the viruses used, and reviewing the safety and security practices in place. Key data would also come from documents, including standard operating procedures at the labs and during fieldwork, risk assessments of individual experiments, experiment logs and fieldwork notebooks, training records, waste management logs, accident and infection records, facility maintenance and automated systems records, access logs, security camera footage and communications logs. …A COVID-19 origins investigation will need to be negotiated and begun rapidly before relevant data diminishes or disappears entirely as time passes.48


There is no semblance of any of this in the WHO resolution, and one can scarcely imagine that any of it would be permitted by the current administration in China. An investigation held after the pandemic “is under control” cannot possibly be carried out “rapidly,” and is in fact postponed into the indefinite future.
Unfortunately, if there were any documentation in either of the two Wuhan virology institutes that recorded the infection of a laboratory researcher or an escape, or that either had a virus sample that was extremely similar to SARS-CoV-2, one has to assume that such information has already been removed or destroyed.


Others have suggested that an international “commission, independent of the WHO, needs to be set up with the broad objective of how to ameliorate the next pandemic. Its mandate should go well beyond that of the WHO and part of its work could be to look at how COVID-19 started.”49 Unfortunately it is equally difficult to envision such a commission coming to pass.

At present, the origin of SARS-CoV-2 remains unknown. The pros and cons regarding the two alternative possibilities—first, that it arose in the field as a natural evolution, as many virologists maintain, or second, that it may have been the consequence of bat coronavirus research in one of the two virology research institutes located in Wuhan that led to the infection of a laboratory researcher and subsequent escape—are equally based on inference and conjecture. The points gathered in this paper can be no more than suggestive. There is no hard scientific evidence to support either position.



Both are inferences from circumstantial evidence. The US administration’s political hectoring only assures that it will be very difficult if not impossible to ever find out which is true.

Acknowledgements:

The author would like to thank several colleagues with far-better computer skills than he has for supplying many of the electronic references. I would also like to thank several colleagues for reading and commenting on the paper. This manuscript was submitted for publication on May 27, 2020.

Notes

1 Shane Harris et al, “Intelligence officials’ early alarms about possible pandemic went unheeded,” Washington Post, March 21, 2020; Eric Lipton et al, “Despite timely alerts, Trump was slow to act,” New York Times, April 12, 2020; Philip Rucker et al, “As deaths mounted, Trump fixated on stalled economy,” Washington Post, May 3, 2020; Edward Luce, “Inside Trump’s Corona Virus Meltdown,” Financial Times Magazine, May 14, 2020; Fintan O’Toole, “Vector in Chief,” New York Review of Books, 67:8, May 14, 2020; and Fintan O’Toole, “Donald Trump has destroyed the country he promised to make great again,” Irish Times, April 25, 2020.
2 See https://www.scmp.com/news/china/society ... se-system; https://www.bloomberg.com/news/articles ... re-meeting.
3 Liu Caiyu and Leng Shumai, “Biosafety guidelines issued to fix chronic management loopholes at virus labs,” Global Times, February 16, 2020, https://www.globaltimes.cn/content/1179747.shtml.
4 Liu Caiyu and Leng Shumai, “Biosafety guidelines issued to fix chronic management loopholes at virus labs,” Global Times, February 16, 2020, https://www.globaltimes.cn/content/1179747.shtml, and Yuan Zhiming, “Current status and future challenges of high-level biosafety laboratories in China, Journal of Biosafety and Biosecurity, Volume 1, Issue 2, September 2019, pp. 123-127. Accessed at: https://doi.org/10.1016/j.jobb.2019.09.005.
5 Shing Hei Zhan, Benjamin E. Deverman and Yujia Alina Chan, “SARS-CoV-2 is well adapted for humans. What does this mean for re-emergence?” BioRxiv, posted May 2, 2020 on: https://doi.org/10.1101/2020.05.01.073262.
6 Chaolin Huang Yeming Wang, Xingwang Li, Lili Ren, Jianping Zhao, Yi Hu, Li Zhang et al, “Clinical Features of Patients Infected with 2019 Novel Coronavirus in Wuhan, China,” The Lancet, Vol. 395, no. 10223 (February 15, 2020): 497-506, https://doi.org/10.1016/S0140-6736(20)30183-5.
7 James T. Areddy, “China rules out Animal Market and Lab as Coronavirus origin,” Wall Street Journal, May 26, 2020, https://www.wsj.com/articles/china-rule ... 1590517508.
8 “Wuhan’s seafood market a victim of COVID-19: CDC director,” Global Times [China], May 26, 2020, https://www.globaltimes.cn/content/1189506.shtml.
9 Botao Xiao and Lei Xiao, “The possible origins of 2091-nCoV coronavirus,” https://img-prod.tgcom24.mediaset.it/im ... da0204.pdf.
10 Jon Cohen, “Chinese researchers reveal draft genome of virus implicated in Wuhan pneumonia outbreak,” Science, January 11, 2020, https://www.sciencemag.org/news/2020/01 ... a-outbreak.
11 Christian Shepherd and Don Weinland, “China Rounds up Wuhan’s Citizen Journalists for ‘Provoking Quarrels’,” Financial Times, May 28, 2020, https://www.ft.com/content/3fd5c031-215 ... 71f6ecf64; Aylin Woodward, “At least 5 people in China have disappeared, gotten arrested, or been silenced after speaking out about the coronavirus — here’s what we know about them,” Business Insider, February 20, 2020, https://businessinsider.com/china-coron ... sh-2020-2; “Coronavirus: Wuhan doctor speaks out against authorities,” The Guardian, March 11, 2020, https://www.theguardian.com/world/2020/ ... thorities; Scott Neuman, Emily Feng and Huojingnan, “China To Investigate After Whistleblower Doctor Dies From Coronavirus,” February 7, 2020, https://www.npr.org/sections/goatsandso ... ronavirus; Verna Yu, “’Hero who told the truth’: Chinese rage over coronavirus death of whistleblower doctor,” The Guardian, February 7, 2020, https://wwwthe.guardian.com/global-deve ... i-wenliang.
12 “A 4th Chinese citizen journalist was reportedly detained after livestreaming what life was like in Wuhan at the height of its coronavirus outbreak,” Business Insider, https://www.businessinsider.com/zhang-z ... han-2020-5. This paper does not attempt to resolve allegations that have been published claiming that a former graduate student at the WIV, Huang Yan Ling, was the index case and subsequently died or disappeared. The allegations have been denied by the Chinese government as well as by members of the WIV staff. Jun Mai, “Chinese research lab denies rumours of links to first coronavirus patient,” South China Morning Post, February 16, 2020, https://www.scmp.com/news/china/society ... oronavirus.
13 Keoni Everington, “Chinese Media Estimates 500,000 Coronavirus Cases in Wuhan, Quickly deletes News,” Taiwan News, May 19, 2020, https://www.taiwannews.com.tw/en/news/3936718.
14 Elise Thomas, “Chinese diplomats and Western fringe media outlets push the same coronavirus conspiracies,” Australian Strategic Policy Institute, March 24, 2020, https://www.aspistrategist.org.au/chine ... spiracies/. The “Western fringe media” were reposting earlier Russian disinformation posts.
15 Matt Schrader, “Analyzing China’s Coronavirus Propaganda Messaging in Europe,” https://securingdemocracy.gmfus.org/ana ... in-europe/.
16 CGTN, “US operates over 200 military biological laboratories worldwide,” 21 May 2020, https://news.cgtn.com/news/2020-05-21/U ... index.html.
17 Milton Leitenberg, “ Russian Disinformation Campaigns re Biological Weapons in the Putin Era,” https://cissm.umd.edu/sites/default/fil ... utin%20PPT
%2011%20Dec%202019_Rev%208%20May%202020.pdf.
18 Lynn Klotz, “Human error in high-biocontainment labs: a likely pandemic threat,” Bulletin of the Atomic Scientists, February 25, 2019.
19 Lynn Klotz, “The risk of lab-created potential pandemic influenza,” March 2020, https://armscontrolcenter.org/wp-conten ... at-end.pdf.
20 Martin Furmanski, “Threatened pandemics and laboratory escapes: Self-fulfilling prophecies,” Bulletin of the Atomic Scientists, March 31, 2014 and Martin Furmanski, personal communication, May 29, 2020.
21 Robert Walgate, “SARS escaped Beijing lab twice: Laboratory safety at the Chinese Institute of Virology under close scrutiny,” The Scientist, April 24, 2004, https://www.the-scientist.com/news-anal ... wice-50137.
22 Rosie McCall, “Almost 100 Lab Workers in China Infected With Potentially Deadly Pathogen,” Newsweek, December 17, 2019, https://www.newsweek.com/almost-100-lab ... en-1477652.
23 Lei-Ping Zeng et al, “Bat SARS-like coronavirus WIV1 encodes an extra accessory protein ORFX involved in modulation of host immune response,” Journal of Virology 2016 May 11:JVI-03079, https://jvi.asm.org/content/jvi/early/2 ... 5.full.pdf.
24 Laboratory biorisk management for laboratories handling human specimens suspected or confirmed to contain novel coronavirus: Interim recommendations, https://www.who.int/csr/disease/coronav ... endations_
NovelCoronavirus_19Feb13.pdf; Centers for Disease Control and Prevention, “Appendix F5— Laboratory Biosafety Guidelines for Handling and Processing Specimens Associated with SARS-CoV. Supplement F: Laboratory Guidance. Public Health Guidance for Community-Level Preparedness and Response to Severe Acute Respiratory Syndrome (SARS) Version 2/3,” https://www.cdc.gov/sars/guidance/f-lab/app5.html.
25 John Xie, “Chinese Lab with Checkered Safety Record Draws Scrutiny over Covid-19,” VOA News, April 21, 2020, https://www.voanews.com/covid-19-pandem ... r-covid-19.
26 Josh Rogin, “State Department cables warned of safety issues at Wuhan lab studying bat coronaviruses,” Washington Post, April 14, 2020.
27 Josh Rogin, “State Department cables warned of safety issues at Wuhan lab studying bat coronaviruses.” A press item reported that an alleged 15-page “Five Eyes” intelligence report shared among the US, UK, Australia, Canada and New Zealand validated many of the charges against the WIV. Dave Makichuk, “Dossier an indictment of China’s virus response,” The Saturday Telegraph [UK], May 3, 2020. However, the Australian government announced that the “report” had been prepared from open source materials by the US alone, was not an agreed intelligence report, and was leaked by the US embassy to a Rupert Murdoch publication. Anthony Galloway and Eryk Bagshaw, “Australian intelligence knocks back US government’s Wuhan lab virus claim,” Sydney Morning Herald, May 4, 2020, https://www.smh.com.au/politics/federal ... 4pk3.html; Anthony Galloway and Eryk Bagshaw, “Australian concern over US spreading unfounded claims about Wuhan lab,” Sydney Morning Herald, May 7, 2020, https://www.smh.com.au/politics/federal ... 54qhp.html.
28 See https://projectreporter.nih.gov/project ... ASC&pball=
29 Fred Guteri et al, “The Controversial Experiments and Wuhan Lab suspected of Starting Pandemic,” Newsweek, April 30, 2020.
30 Vineet D. Menachery et al, “A SARS-like Cluster of Circulating Bat Coronaviruses Shows Potential for Human Emergence,” Nat Med. 2015 Dec; 21(12):1508-13. doi: 10.1038/nm.3985. Epub 2015 Nov 9, https://pubmed.ncbi.nlm.nih.gov/26552008/.
31 LP Zeng et al, “Bat Severe Acute Respiratory Syndrome-Like Coronavirus WIV1 Encodes an Extra Accessory Protein, ORFX, Involved in Modulation of the Host Immune Response,” J Virol. 2016 Jun 24;90(14):6573-6582. doi: 10.1128/JVI.03079-15. Print 2016 Jul 15, (methods for construction of chimeric coronaviruses, https://pmlegacy.ncbi.nlm.nih.gov/pubmed/27170748.
32 B. Hu et al, “Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus,” PLoS Pathog. 2017 Nov 30;13(11):e1006698. doi: 10.1371/journal.ppat.1006698. eCollection 2017 Nov, (construction of chimeric coronaviruses encoding different S proteins), https://pmlegacy.ncbi.nlm.nih.gov/pubmed/29190287.
33 Yuri Deigin, “Lab-Made? SARS-CoV-2 Genealogy Through the Lens of Gain-of-Function Research, April 22, 2020, https://medium.com/@yurideigin/lab-made ... 6dd7413748 and Jonathan Latham and Allison Wilson, “The Case is Building That COVID-19 Had a Lab Origin,” Independent Science News, June 2, 2020, https://www.independentsciencenews.org/ ... ab-origin/.
34 Wuhan Institute of Virology, CAS, “Take a look at the largest virus bank in Asia,” 2018, http://english.whiov.cas.cn/ne/201806/t ... 93863.html.
35 Jane Qiu, “How China’s ‘Bat Woman’ Hunted Down Viruses from SARS to the New Coronavirus,” Scientific American, June 2020, https://www.scientificamerican.com/arti ... onavirus1/
36 Jon Cohen and Kai Kupferschmidt, “NIH-halted study unveils ist massive analysis of bat coronaviruses,” Science, June 2, 2020, https://www.sciencemag.org/news/2020/06 ... onaviruses.
37 Agence France Presse, “Wuhan lab had three live bat coronaviruses: Chinese state media,” May 24, 2020, https://au.news.yahoo.com/wuhan-lab-had ... -033127925–spt.html.
38 Personal communication, May 24, 2020.
39 Jonathan Latham and Allison Wilson, “The Case is Building That COVID-19 Had a Lab Origin,” Independent Science News, June 2, 2020, https://www.independentsciencenews.org/ ... ab-origin/.
40 Press Release, Flinders University, “Origins of COVID-19 still a mystery”, May 14, 2020; Sakshi Piplani et al, “In Silico Comparison of Spike Protein-ACE2 Binding Affinities across Species: Significance for the Possible Origin of the SARS-CoV-2 Virus,” ArXiv:2005.06199 [q-Bio], May 13, 2020, http://arxiv.org/abs/2005.06199. See also, Jeremy Andre, “Origine du coronavirus: ‘L’Infection d’un employé de laboratoire de Wuhan est plus probable’,” Le Point International, April 18, 2020 and Jef Akst, “Lab-Made Coronavirus Triggers Debate,” The Scientist, November 16, 2015 (updated March 11, 2020), https://www.the-scientist.com/news-opin ... bate-34502.
41 John Xie, “Chinese Lab with Checkered Safety Record Draws Scrutiny over COVID-19,” VOA News, April 21, 2020, https://www.voanews.com/covid-19-pandem ... r-covid-19.
42 Kenneth Rapoza, “China Lab in Focus of Corona Virus Outbreak,” Forbes, April 14, 2020, https://www.forbes.com/sites/kenrapoza/ ... -outbreak/.
43 Patrick Smith, “WHO official says agency not invited to take part in China’s coronavirus investigation,” NBC News, May 1, 2020, https://nbcnews.com/news/world/who-offi ... s-n1197516.
44 Gerry Shih, “China’s Xi backs WHO-led review of covid-19 outbreak, proposes aid for developing world,” Washington Post, May 18, 2020, https://www.washingtonpost.com/world/as ... story.html.
45 Gerry Shih, “China’s Xi backs WHO-led review of covid-19 outbreak, proposes aid for developing world,” Washington Post, May 18, 2020, https://www.washingtonpost.com/world/as ... story.html.
46 WHO, Draft Resolution: COVID-19 response, A73/CONF./1 Rev.1, May 18, 2020, https://apps.who.int/gb/ebwha/pdf_files ... ev1-en.pdf.
47 “Editorial: Virus investigation must be fair, scientific,” Global Times, May 17, 2020, https://www.globaltimes.cn/content/1188620.shtml. On May 4, 2020, a Chinese Hsinhua publication asked the question “Where did the virus in the U.S. originate?”: “On March 11, CDC Director Robert Redford told a hearing on Capitol Hill that some COVID-19 deaths have been diagnosed as flu-related in the United States. Washington needs to clarify the number of COVID-19 cases previously diagnosed as flu, and make public the samples and genetic sequence of the influenza virus in the country.” “Spotlight: Five Questions Washington needs to answer on coronavirus pandemic,” XINHUANET, May 4, 2020.
48 Filippa Lentzos, “Will the WHO call for an international investigation into the coronavirus’s origins?”, The Bulletin of the Atomic Scientists, May 18, 2020.
49 Personal communication, Rod Barton, May 25, 2020.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 5:57 am

Human error in high-biocontainment labs: a likely pandemic threat
by Lynn Klotz
Bulletin of the Atomic Scientists
February 25, 2019

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.



Image
A CDC staff microbiologist examines reconstructed 1918 Pandemic Influenza Virus at a Biosafety Level 3-enhanced lab. Photo Credit: James Gathany/CDC

Incidents causing potential exposures to pathogens occur frequently in the high security laboratories often known by their acronyms, BSL3 (Biosafety Level 3) and BSL4. Lab incidents that lead to undetected or unreported laboratory-acquired infections can lead to the release of a disease into the community outside the lab; lab workers with such infections will leave work carrying the pathogen with them. If the agent involved were a potential pandemic pathogen, such a community release could lead to a worldwide pandemic with many fatalities. Of greatest concern is a release of a lab-created, mammalian-airborne-transmissible, highly pathogenic avian influenza virus, such as the airborne-transmissible H5N1 viruses created in the laboratories of Ron Fouchier in the Netherlands and Yoshihiro Kawaoka In Madison Wisconsin.

[T]wo researchers, Ron Fouchier who's up at the University of Erasmus in Netherlands, and Yoshihiro Kawaoka who is a researcher at University of Wisconsin, they said, "You know what, this isn't very infective, this bird flu. What if we were able to create a version that is airborne? You could get like the common cold. Let's try that." And they did. They actually were able to create this virus. So if this virus escapes, right, 1.6 billion people could die, 60% of the world's population. Well, this caused a huge furor. In 2014, the Obama administration actually declared a moratorium on this gain of function-gain of threat... They said, "This is just too dangerous."

-- Interview with Andrew Kimball on the Ralph Nader Radio Show, July 18, 2020


Such releases are fairly likely over time, as there are at least 14 labs (mostly in Asia) now carrying out this research. Whatever release probability the world is gambling with, it is clearly far too high a risk to human lives. Mammal-transmissible bird flu research poses a real danger of a worldwide pandemic that could kill human beings on a vast scale.

Human error is the main cause of potential exposures of lab workers to pathogens. Statistical data from two sources show that human error was the cause of, according to my research, 67 percent and 79.3 percent of incidents leading to potential exposures in BSL3 labs. These percentages come from analysis of years of incident data from the Federal Select Agent Program (FSAP) and from the National Institutes of Health (NIH). (Details may be found in the Supplementary Material document.)

Understanding human error is important to calculating the probability that a pathogen will be released from a lab into the surrounding community, the first step in calculating the likelihood of a pandemic. A key observation is that human error in the lab is mostly independent of pathogen type and biosafety level. Analyzing the likelihood of release from laboratories researching less virulent or transmissible pathogens therefore can serve as a reasonable surrogate for how potential pandemic pathogens are handled. (We are forced to deal with surrogate data because, thank goodness, there are little data on the release of potentially pandemic agents.) Put another way, surrogate data allows us to determine with confidence the probability of release of a potentially pandemic pathogen into the community. In a 2015 publication, Fouchier describes the careful design of his BSL3+ laboratory in Rotterdam and its standard operating procedures, which he contends should increase biosafety and reduce human error. Most of Fouchier’s discussion, however, addresses mechanical systems in the laboratory.

But the high percentage of human error reported here calls into question claims that state-of-the-art design of BSL3, BSL3+ (augmented BSL3), and BSL4 labs will prevent the release of dangerous pathogens. How much lab-worker training might reduce human error and undetected or unreported laboratory acquired infections remains an open question. Given the many ways by which human error can occur, it is doubtful that Fouchier’s human-error-prevention measures can eliminate release of airborne-transmissible avian flu into the community through undetected or unreported lab infections.

Human-error incident data.

In its 2016 study for the NIH, “Risk and Benefit Analysis of Gain of Function Research,” Gryphon Scientific looked to the transportation, chemical, and nuclear sectors to define types of human error and their probabilities. As Gryphon summarized in its findings, the three types of human error are skill-based (errors involving motor skills involving little thought), rule-based (errors in following instructions or set procedures accidentally or purposely), and knowledge-based (errors stemming from a lack of knowledge or a wrong judgment call based on lack of experience).

Gryphon claimed that “no comprehensive Human Reliability Analysis (HRA) study has yet been completed for a biological laboratory… . This lack of data required finding suitable proxies for accidents in other fields.”

But mandatory incident reporting to FSAP and NIH actually does provide sufficient data to quantify human error in BSL3 biocontainment labs.

Federal Select Agent Program incident data.

FSAP incident data were collected from summary reports to Congress for the years 2009 through 2015.

Three of the seven FSAP incident categories involve skill-based errors: 1) needle sticks and other through the skin exposures from sharp objects, 2) dropped containers or spills/splashes of liquids containing pathogens, and 3) bites or scratches from infected animals. Some skill errors, such as spills and needle sticks could be reduced with simple fixes (see below).

The rule-based and knowledge-based incident categories are: 4) pathogens manipulated outside of a biosafety cabinet or other equipment designed to protect exposures to infectious aerosols; 5) potential exposures resulting from non-adherence to safety procedures or deviations from lab standard operating procedures, and 6) failure or problem with personal protective equipment -- a mix of skill, rule, or knowledge-based errors.

The seventh category is mechanical or equipment failure, or defective labware. Another category not mentioned in the FSAP reports is failure to properly inactivate pathogens before transferring them to a lower biosafety level lab for further research.

During the 2009-2015 time period, FSAP received a total of 749 incident reports from select-agent research facilities. Conservatively, 594 or 79.3 percent of those incidents involve human error. (Details may be found in the Supplementary Material.)

National Institutes of Health incident data.

Incident reports to the NIH Office of Science Policy cover the period from 2004 through 2017 and BSL3 and BSL4 facilities. They were obtained through a Freedom of Information Act request.

There were no reported incidents from BSL4 facilities. Reporting to NIH is required only for incidents involving pathogens that contain recombinant DNA. While it is highly likely there have been incidents in BSL4 facilities, they may not have involved pathogens with recombinant DNA and so would not show up in the reports to NIH.

The 128 incident reports provide extremely detailed descriptions. The reports are often several-dozen pages long so almost no questions remain about details.

Of the 128 incidents, 86 or 67.2 percent were due to human error. This percentage is in the same ballpark as the FSAP reports.

Some human errors are “one-off,” meaning they happened once and likely won’t happen again. One-off errors are difficult to anticipate, so it is unlikely that one can devise meaningful changes in standard operating procedures to prevent them. Here is one example of a one-off error, slightly modified from an incident report:

A researcher was exchanging two plastic 24-well plates in the tabletop Sorvall centrifuge. While closing the lid, it was caught on a centrifuge wrench which was accidentally placed into the path of the lid. The wrench jumped and knocked one of the removed 24-well plates onto the counter. The plate landed at approximately a 45-degree angle and lost approximately half its contents to the bench top.

For some errors, there are procedural changes that should reduce their frequency. For instance, needle sticks can occur from syringes with sharp metal needles when being used to transfer liquids from one small container to another. For injecting animals, sharp metal needles are needed; but for liquid transfers, blunt-plastic needles would suffice. Also, dropping items could sometimes be prevented using lab carts to transport items from place to place, rather than carrying them by hand.

Here are three comments from the aforementioned Fouchier publication.

• “Only authorized and experienced personnel that have received extensive training can access the facility.”
• “All personnel have been instructed and trained how to act in case of incidents.”
• “For animal handling, personnel always work in pairs to reduce the chance of human error.”

The first two bullets speak to standard training of lab workers who work with particularly dangerous pathogens. It is unclear whether the diligent training of lab workers he outlines would substantially reduce human error:

The entities reporting incidents to NIH mention similar diligent training; nonetheless, undetected or unreported laboratory acquired infections occur with high frequency in these laboratories. Furthermore, it is unclear whether other laboratories creating and researching airborne-transmissible diseases are so carefully designed and diligent in their training.

The two-person rule for animal handling is a good idea that is not typically mentioned in the detailed NIH incident reports. Animal bites and needle punctures brought about by unruly lab animals are not uncommon.


Release from high biocontainment through incomplete inactivation.

Beyond the aforementioned undetected or unreported laboratory-acquired infections lies another route by which pathogens can be released from high biosecure level labs—incomplete inactivation.

Inactivation is designed to destroy the pathogenicity of an infectious agent, while retaining its other characteristics for research in which live pathogens are not needed. Since there are reliable inactivation procedures, failure to inactivate is a human error.

Pathogens are inactivated for research that can be performed in lower BSL2 biocontainment, where it is much easier to carry out. Research in BSL3 and BSL4 laboratories is difficult, both because of restricted movement in the personal protective equipment that must be worn and because of restrictions in operating procedures that aim to minimize potential exposure to pathogens.

While incomplete inactivation does not usually directly cause a release into the community, researchers in BSL2 labs are at a much higher risk of infection, and their street clothes, hair, and skin can become contaminated. But incomplete inactivation is a route to potential release into the community.

The FSAP does not routinely collect data on incomplete inactivation, and it seems no one else does either. Thus, enough data to calculate probabilities for this type of incident are not available. But the Government Accountability Office (GAO) has weighed in on the issue. The GAO reports anecdotal evidence and some numbers on incomplete inactivation to support the contention that it is a serious issue. The office has identified 11 incidents, in addition to 10 incidents already identified by the FSAP. Notably, two of the incidents involved Ebola and Marburg viruses, which because of a lack of countermeasures (vaccines and antivirals) are researched at BSL4 facilities.

Among other things, the GAO report called attention to a well-publicized incident in which a Defense Department laboratory “inadvertently sent live Bacillus anthracis, the bacterium that causes anthrax, to almost 200 laboratories worldwide over the course of 12 years. The laboratory believed that the samples had been inactivated.” The report describes yet another well-publicized incident in China in which “two researchers conducting virus research were exposed to severe acute respiratory syndrome (SARS) coronavirus samples that were incompletely inactivated. The researchers subsequently transmitted SARS to others, leading to several infections and one death in 2004.”

The GAO identified three recent releases of Ebola and Marburg viruses from BSL4 to lower containment labs due to incomplete inactivation.

A fourth release in 2014 from the CDC labs occurred when “Scientists inadvertently switched samples designated for live Ebola virus studies with samples intended for studies with inactivated material. As a result, the samples with viable Ebola virus, instead of the samples with inactivated Ebola virus, were transferred out of a BSL-4 laboratory to a laboratory with a lower safety level for additional analysis. While no one contracted Ebola virus in this instance, the consequences could have been dire for the personnel involved as there are currently no approved treatments or vaccines for this virus.”


The CDC has issued a report on this mixup, and the steps they have taken to avoid this particular error in the future.

All these incidents confirm the role of incomplete inactivation that would lead to an increased likelihood of release into the community from a BSL2 lab. These are all human errors, some involving BSL4 pathogens. Along with the observation that other human errors are the cause of more than two-thirds of potential exposures in BSL3 labs, it is clear that state-of-the-art laboratory design will not prevent release into the community.

The probability of release into the community.

In an analysis circulated at the 2017 meeting for the Biological Weapons Convention, a conservative estimate shows that the probability is about 20 percent for a release of a mammalian-airborne-transmissible, highly pathogenic avian influenza virus into the community from at least one of 10 labs over a 10-year period of developing and researching this type of pathogen. This percentage was calculated from FSAP data for the years 2004 through 2010.

Analysis of the FOIA NIH data gives a much higher release probability—that is, a factor five to 10 times higher, based on a smaller number of incident reports.


While there is no obvious reason in the NIH data that would explain this high probability, exposures and latent (not-active) infections with M. tuberculosis was indicated in four incident reports. M. tuberculosis is not a select agent so incidents involving it would not necessarily be reported to the FSAP. Tuberculosis is highly contagious by the airborne route, so it might be easier to acquire a TB infection in the lab. Unfortunately, airborne TB infections might be a harbinger of what could occur in research on airborne-transmissible flu.

Facility-reported descriptions of the 11 relevant incidents are provided in the Supplementary Material (Appendix 2). Lab-acquired infections are often discovered some time after the incident occurred. Only for three were the causes confirmed to be human error. For the other eight, neither the infected lab workers nor facility officials knew how the infection occurred. While it is likely that human error was involved in many of these eight infections, their causes will never be known.

Likelihood that mammalian-airborne-transmissible, highly pathogenic avian influenza release could cause a deadly pandemic.

The avian flu virus H5N1 kills 60 percent of people who become infected from direct contact with infected birds. The mammalian-airborne-transmissible, highly pathogenic avian influenza created in the Fouchier and Kawaoka labs should be able to infect humans through the air, and the viruses could be deadly.

A release into the community of such a pathogen could seed a pandemic with a probability of perhaps 15 percent. This estimate is from an average of two very different approaches. One approach involves purely mathematical branching theory, where Harvard researcher Marc Lipsitch and coworkers provide a graph in which, conservatively, the probability that a pandemic is seeded from a single release is about 20 percent. In the second approach, where infection progress through the community from person to person is simulated, Bruno Kessler Foundation researcher Stefano Merler and coworkers found that there is a probability from five percent to 15 percent that a single release could seed a pandemic. How deadly and how transmissible such viruses are in humans is not known.


Dealing realistically with human errors in lab research. Human error will continue to play a major role in laboratory incidents, and undetected or unreported laboratory acquired infections and incomplete inactivation incidents will continue to occur. No matter how well facilities are designed to prevent release into communities, human error will dodge design.

For an already identified 14 labs creating or researching mammalian-airborne-transmissible, highly pathogenic avian influenza, the potential 16 percent probability of a laboratory release into the community over five years of research (a result found in a study now being prepared for publication) is already uncomfortably high. NIH incident reports indicate possibly much higher probabilities of a such a release -- thus, a greater likelihood of a pandemic. This does not take into the account a release from incomplete inactivation. Combining release probability with the not insignificant probability that an airborne-transmissible influenza virus could seed a pandemic, we have an alarming situation.

Those who support mammalian-airborne-transmissible, highly pathogenic avian influenza experiments either believe the probability of community release is infinitesimal or the benefits in preventing a pandemic are great enough to justify the risk. For this research, it would take extraordinary benefits and significant risk reduction via extraordinary biosafety measures to correct such a massive overbalance of highly uncertain benefits to too-likely risks.

Whatever probability number we are gambling with, it is clearly far too high a risk to human lives. There are experimental approaches that do not involve live mammalian-airborne-transmissible, highly pathogenic avian influenza which identify mutations involved in mammalian airborne transmission. These “safer experimental approaches are both more scientifically informative and more straightforward to translate into improved public health…” Asian bird flu virus research to develop live strains transmissible via aerosols among mammals (and perhaps some other potentially pandemic disease research as well), should for the present be restricted to special BSL4 laboratories or augmented BSL3 facilities where lab workers are not allowed to leave the facility until it is certain that they have not become infected.


It must be emphasized that the focus here is for only a very small subset of pathogen research. Most pathogen research should proceed unimpeded by unnecessary regulations.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 6:53 am

Bat Severe Acute Respiratory Syndrome-Like Coronavirus WIV1 Encodes an Extra Accessory Protein, ORFX, Involved in Modulation of the Host Immune Response
by Lei-Ping Zeng, Yu-Tao Gao, Xing-Yi Ge, Qian Zhang, Cheng Peng, Xing-Lou Yang, Bing Tan, Jing Chen, Aleksei A. Chmura, Peter Daszak, and Zheng-Li Shi
S. Perlman, Editor
University of Iowa
Copyright © 2016, American Society for Microbiology. All Rights Reserved.

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


There have been three publications, in 2015,30 2016 and 2017, describing the WIV gain of function research. The WIV, having learned both basic and traceless infectious-clone technology from joint research with a laboratory at the University of North Carolina (UNC) in 2015, initiated construction of novel chimeric coronaviruses without UNC immediately thereafter. WIV’s first publication on the use of basic infectious-clone technology to construct novel chimeric coronaviruses at WIV appeared in 2016.31 WIV’s first publication on the use of traceless, signature-free infectious-clone technology also appeared in 2016.32

-- Did the SARS-CoV-2 virus arise from a bat coronavirus research program in a Chinese laboratory? Very possibly, by Milton Leitenberg


ABSTRACT

Bats harbor severe acute respiratory syndrome (SARS)-like coronaviruses (SL-CoVs) from which the causative agent of the 2002-2003 SARS pandemic is thought to have originated. However, despite the fact that a large number of genetically diverse SL-CoV sequences have been detected in bats, only two strains (named WIV1 and WIV16) have been successfully cultured in vitro. These two strains differ from SARS-CoV only in containing an extra open reading frame (ORF) (named ORFX), between ORF6 and ORF7, which has no homology to any known protein sequences. In this study, we constructed a full-length cDNA clone of SL-CoV WIV1 (rWIV1), an ORFX deletion mutant (rWIV1-ΔX), and a green fluorescent protein (GFP)-expressing mutant (rWIV1-GFP-ΔX). Northern blotting and fluorescence microscopy indicate that ORFX was expressed during WIV1 infection. A virus infection assay showed that rWIV1-ΔX replicated as efficiently as rWIV1 in Vero E6, Calu-3, and HeLa-hACE2 cells. Further study showed that ORFX could inhibit interferon production and activate NF-κB. Our results demonstrate for the first time that the unique ORFX in the WIV1 strain is a functional gene involving modulation of the host immune response but is not essential for in vitro viral replication.

IMPORTANCE

Bats harbor genetically diverse SARS-like coronaviruses (SL-CoVs), and some of them have the potential for interspecies transmission. A unique open reading frame (ORFX) was identified in the genomes of two recently isolated bat SL-CoV strains (WIV1 and -16). It will therefore be critical to clarify whether and how this protein contributes to virulence during viral infection. Here we revealed that the unique ORFX is a functional gene that is involved in the modulation of the host immune response but is not essential for in vitro viral replication. Our results provide important information for further exploration of the ORFX function in the future. Moreover, the reverse genetics system we constructed will be helpful for study of the pathogenesis of this group of viruses and to develop therapeutics for future control of emerging SARS-like infections.

INTRODUCTION

Severe acute respiratory syndrome coronavirus (SARS-CoV) is a zoonotic pathogen that caused the 2002-2003 SARS pandemic, which originated in China (1). Since then, genetically diverse SARS-like coronaviruses (SL-CoVs) have been reported in bats in China, Europe, and Africa (2,–11), indicating a wide geographic distribution of this group of viruses. However, most bat SL-CoVs have been identified only by sequences and are not fully characterized due to the lack of cultured viruses. Thus, their potential for transmission to and likely pathogenesis in domestic animals and humans remain untested. WIV1 and WIV16 are two recently identified SL-CoV strains with high genomic similarity to human SARS-CoV. These two strains have been successfully cultured in vitro and have been shown to use the same molecule (angiotensin-converting enzyme [ACE2]) for cellular entry as SARS-CoV (2, 10). Recently, another bat SL-CoV strain, SHC014, has been demonstrated to use human ACE2 by the construction of an infectious cDNA clone (12). Furthermore, animal infection experiments indicated that SL-CoV WIV1 and SHC014 could replicate efficiently and caused low pathogenesis in ACE2 transgenic mice (12, 13). The fact that the native bat SL-CoVs could use human ACE2 without any mutations indicates a high risk of interspecies transmission for these and similar coronaviruses that may exist in natural reservoirs.

Coronaviruses have the largest genomes among RNA viruses. Their genomes consist of a positive, single-stranded RNA of around 30,000 nucleotides (nt), with two-thirds at the 5′ end encoding genome replication proteins (ORF1ab) and one-third at the 3′ end encoding structural proteins, including a spike glycoprotein (S), a small envelope protein (E), a membrane protein (M), and a nucleocapsid protein (N). Coronaviruses carry a set of open reading frames (ORFs) expressed from full-length mRNAs and subgenomic-length mRNAs (sgRNAs), which have a common 3′ end originating at distinct transcription regulatory sequences (TRS) and joined with a common leader sequence encoded at the 5′ end of genomic RNA (14). Currently, coronaviruses are divided into the genera Alphacoronavirus, Betacoronavirus, and Gammacoronavirus and the proposed genus Deltacoronavirus (15). SARS-CoV and SL-CoVs are grouped into the same coronavirus species, SARS-related coronavirus (SARSr-CoV), within the genus Betacoronavirus. Besides the family-conserved genes, SARSr-CoV possesses several accessory genes, including ORF3, ORF6, ORF7, ORF8, and ORF9, which are specific for this group of coronaviruses but not essential for in vitro viral replication (16,–18). Accessory genes in coronavirus genomes play important roles in regulating the host immune response (19). The SARS-CoV ORF3a, ORF3b, and ORF6 have been reported to inhibit the host interferon (IFN) response during virus infection and contribute to pathogenesis (20, 21). ORF3a and ORF7a activate NF-κB and upregulate interleukin-8 (IL-8) and CCL5 production (22, 23). Bat SL-CoVs display great genetic diversity and share overall nucleotide sequence identities of 88 to 97% with human SARS-CoV (2,–11). Bat SL-CoVs WIV1 and WIV16 are the closest relatives to human SARS-CoV discovered so far. These two viruses are identical in genomic structures except that WIV1 and -16 have an extra ORF (named ORFX) between ORF6 and ORF7 with no homology to any known protein sequences (2, 10).

In this study, we explored the function of ORFX in modulating the host immune response through the use of eukaryotic overexpression assays and recombinant viruses generated through reverse genetics techniques.

MATERIALS AND METHODS

Virus and cells.


The SL-CoV WIV1 strain (GenBank accession number KF367457) and other viruses were propagated as described previously (2). Sendai virus (SeV) strain Cantell (kindly provided by Hanzhong Wang) was propagated in 10-day-old embryonated chicken eggs at 37°C for 48 h (24). All experiments using live virus was conducted under biosafety level 2 (BSL2) conditions. HeLa cells stably expressing human ACE2 (HeLa-hACE2) were described previously (25). 293T, Vero E6, HeLa, and HeLa-hACE2 cells were grown and propagated in Dulbecco's modified Eagle's medium (GIBCO, Invitrogen) supplemented with 10% fetal bovine serum (Life Technologies). Calu-3 cells were grown and propagated in Dulbecco's modified Eagle's medium–nutrient mixture F-12 medium supplemented with 15% fetal bovine serum. Cells were grown at 37°C in a humidified atmosphere with 5% CO2.

Plasmids.

The coding region of ORFX was amplified by reverse transcription-PCR (RT-PCR) from viral RNA using the Superscript one-step RT-PCR kit (Invitrogen). The amplified gene was cloned into plasmid pCAGGS with a C-terminal hemagglutinin (HA) tag (pCAGGS-ORFX) for eukaryotic expression. Reporter plasmids used included pIFNκ-Luc (expressing firefly luciferase under the control of the IFN-β promoter), pNF-κB-Luc (expressing firefly luciferase under the control of the NF-κB promoter), and pRL-TK (expressing Renilla luciferase under the control of the herpes simplex virus thymidine kinase promoter), as well as an expression plasmid for influenza virus NS1, as described previously (24). Plasmids expressing subcellular organelle markers, including SecG1β-green fluorescent protein (GFP) (endoplasmic reticulum [ER] marker), B4Gal-Ti-red fluorescent protein (RFP) (Golgi apparatus marker), and Mito-yellow fluorescent protein (YFP) (mitochondrion marker), were kindly provided by Yanyi Wang of the Wuhan Institute of Virology.

Viral infection assays.

Vero E6, Calu-3, and HeLa-hACE2 cells were infected with viruses at a multiplicity of infection (MOI) of 1.0, 0.1, or 0.001 in 25-cm2 flasks with a 1-h adsorption period, followed by two washes with D-Hanks solution and culturing by adding 3 ml of medium. The viral supernatants were harvested, at 0, 2, 6, 12, 18, 24, 36, 48, and 72 h postinoculation, with 300 μl removed and 300 μl medium added back at each time point. The virus concentration was titrated by plaque assay in Vero E6 cells.

Vero E6 cells were infected by rWIV1-GFP-ΔX or mock infected. After 24 h, fluorescence micrographs was taken to check the expression of green fluorescent protein.

Cloning of WIV1 cDNAs.

The virus genome was divided into 8 continuous fragments (A to G) and amplified using specific primers (primer sequences are available upon request). Viral RNA was extracted from the supernatant of WIV1-infected cultures and reverse transcribed with Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega) and random hexamer deoxynucleotide primers. The cDNA was denatured for 5 min at 95°C and amplified by PCR with KOD DNA polymerase (Toyobo) for 20 cycles of 95°C for 30 s, 60°C for 30 s with a 0.5°C decrease per cycle, and 68°C for 5 min, 15 cycles of 95°C for 30 s, 50°C for 30 s, and 68°C for 5 min, and a final extension at 68°C for 10 min. The amplicons were cloned into pGEM-T Easy (Promega). Besides three natural BglI sites, several BglI sites were introduced by synonymous mutations in the PCR process to make all contiguous cDNA fragments capable of unidirectional ligation. SacII and AscI sites were introduced into the 5′ terminus of fragment A and the 3′ terminus of fragment G, respectively. A poly(A) sequence (25 nt) was added to the 3′ terminus of fragment G. At least three colonies of each cDNA clone were sequenced, and the one identical to or with some synonymous mutations to the reported sequence was selected for assembly.

To ablate a natural BglI site at position 1575, primers FA, F-c1575a, R-c1575a, and RA were used for overlap extension PCR (OE-PCR) to introduce the synonymous mutation C1575A (primer sequences are available upon request). Based on previous in vitro transcription tests, the synonymous mutation T27527C was also introduced to interrupt a potential T7 termination site via OE-PCR.

Strategy for modifying pBeloBAC11.

The cytomegalovirus (CMV) promoter was amplified from pcDNA3.1(+) (Thermo Fisher Scientific) with forward primer 5′-TGAGGATCCCGTTGACATTGATTATTGACTAG-3′ and reverse primer 5′-CCTGACTGCAGGTCGACTGCCGCGGAGCTCTGCTTATATAGACC-3′. Hepatitis delta virus (HDV) ribozyme was synthesized as described previously (26), and amplified with forward primer 5′-CAGTCGACCTGCAGTCAGGCGCGCCGGGTCGGCATGGCATCTCC-3′ and reverse primer 5′-CTAGAAGGCACAGCTCCCTTAGCCATCCGAGTGG-3′. The bovine growth hormone (BGH) transcription terminal signal was amplified from pcDNA3.1(+) with forward primer 5′-GGATGGCTAAGGGAGCTGTGCCTTCTAGTTGCCAGC-3′ and reverse primer 5′-TGAAAGCTTCCATAGAGCCCACCGCATCC-3′. The three PCR products then were ligated using OE-PCR, with BamHI and HindIII sites flanking the amplicon and SacII and AscI sites between the CMV promoter and HDV ribozyme. The amplicon was then inserted into pBeloBAC11 (New England BioLabs) between BamHI and HindIII sites. The construct was designated pBAC-CMV.

Construction of infectious bacterial artificial chromosome (BAC) clones of WIV1.

Subclone A and subclone G were first digested with SacII and AscI (New England BioLabs), respectively, followed by treatment with calf intestinal alkaline phosphatase (CIAP) (TaKaRa), chloroform extraction, and isopropanol precipitation, and then restricted with BglI (TaKaRa). Subclones B to F were digested with BglI. pBAC-CMV was digested with SacII and AscI. All digestion products were then separated using 1% agarose gels, excised, and purified by using a gel extraction kit (Omega). Digested fragments A to G and pBAC-CMV were ligated overnight at 4°C, transformed into DH10B competent cells, and plated on Chl+ LB culture. Ten clones were screened by restriction fragment length polymorphism (RFLP) analysis with NcoI, StuI, or HindIII. The correct clone was named pBAC-CMV-rWIV1 (Fig. 1).

Image
FIG 1. Strategy for construction of an infectious WIV1 BAC clone. (A) Genomic structure of WIV1. (B) The mutations are indicated under the stars. C1575A was used to ablate a natural BglI site at nucleotide 1571 (▽), and T27527C was used to disrupt a potential T7 stop site. The others were for introducing BglI sites (▼). (C) The WIV1 genome was split into eight contiguous cDNAs (A to G): A, nt 1 to 4387; B, nt 4388 to 8032; C1, nt 8033 to 10561; C2, nt 10562 to 12079; D, nt 12080 to 17017; E, nt 17018 to 22468; F, nt 22469 to 27352; G, nt 27353 to 30309. Unique BglI sites were introduced into the fragments by synonymous mutations to make these fragments capable of unidirectional ligation along with native BglI sites in the genome. The original nucleotides are shown above the flanking sequences of corresponding fragments. A poly(A) sequence was added to the 3′ terminus of fragment G. A CMV promoter, HDV ribozyme, and BGH transcriptional terminal signal were inserted into pBeloBAC11 between BamHI and HindIII sites. SacII and AscI sites were introduced between the CMV promoter and ribozyme. Fragments A to G were inserted into the pBAC-CMV plasmid in a single step.

Construction of WIV1 mutants.

To delete ORFX, the fragment F was PCR amplified with primers FF (5′-ACCTGTGCCCTTTTGGCGAGGTTTTTAATGCTACTAC-3′) and RFox (5′-GCCTCTAGGGCTCAAGGATAATCTATCTCCATAGG-3′). Fragment G was PCR amplified with FGox (5′-GCCCTAGAGGCAACGAACATGAAAATTATTCTCTTCC-3′) and RG (5′-ACTGGCGCGCCTTTTTTTTTTTTTTTTTTTTTTTTTGTCATTCTCCTGAGAAGC-3′). This new fragment was named Gox. These two products were then cloned into pGEM-T Easy. The two fragments were inserted into the BAC along with the other fragments as described above. The rescued mutant was named as rWIV1-ΔX. To place GFP into the open reading frame of ORFX, the F fragment was amplified with primers FF and RFoeGFP (5′-GCTCACCATAGTGGTTCGTTTATCAAGGATAATCTATCTCC-3′). The GFP gene was amplified with primers 5′-CCTTGATAAACGAACCACTATGGTGAGCAAGGGCGAGGAGC-3′ and 5′-TGCCTCTAGGGCTTACTTGTACAGCTCGTCCATGCC-3′. The two PCR products were ligated by OE-PCR, and the product was inserted into pGEM-T Easy. The rescued mutant was named rWIV1-GFP-ΔX.

Transfection of infectious WIV1 BAC clones.

Vero E6 cells were seeded in a 6-well plate a day in advance, and then one well was transfected with 6 μg infectious BAC plasmids constructed as described above with Lipofectamine LTX and Plus reagent (Life Technologies). Virus progeny was plaque purified once. One clone was passaged once in Vero E6 cells for 72 h and used to generate a stock for future use.

RFLP.

RNAs extracted from wild-type and recombinant viruses were reverse transcribed with random hexamer primers. RT-PCR was used to generate five amplicons containing the five mutations designed in the strategy. These amplicons included a 1,124-bp amplicon (nucleotide positions 1312 to 2435) spanning a naturally occurring BglI site at nucleotide 1571 that had been ablated in recombinant viruses, a 1,438-bp amplicon spanning the B/C1 junction (nucleotide positions 7560 to 8997), a 1,437-bp amplicon spanning the C1/C2 junction (nucleotide positions 10196 to 11632), a 1,437-bp amplicon spanning the D/E junction (nucleotide positions 16793 to 18229), and a 1,438-bp amplicon spanning the E/F junction (nucleotide positions 21908 to 23345) (these amplicons correspond to fragments F1 to F5 in Fig. 1). The first amplicon of wild-type WIV1 (wtWIV1) that contains nucleotide 1571 can be cleaved by BglI, but the other four amplicons cannot. In contrast, the five amplicons of recombinant viruses are different from those of wild-type virus in the capability of being cut by BglI.

Northern blot analysis.

The N gene was amplified with primers WIV1-NF (5′-ATGTCTGATAATGGACCCCA-3′) and WIV1-3R (5′-GTCATTCTCCTGAGAAGCTA-3′) and used as a template for probe preparation according to the description in the DIG-High Prime DNA labeling and detection starter kit II (Roche). Vero E6 cells were infected with wild-type and recombinant viruses at an MOI of 1.0. At 24 h postinfection, intracellular RNA was isolated using TRIzol reagent (Ambion). RNA (20 μg) was precipitated, treated with 17 μl sample buffer (50% formamide, 2.2 M formaldehyde [37%], 1× morpholinepropanesulfonic acid [MOPS]) at 65°C for 10 min, supplemented with 3 μl 10× dye solution (50% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanole FF), and then separated in a denaturing 0.8% agarose–2.2 M formaldehyde gel at 28 V for ∼17 h. The RNA was hydrolyzed with 0.05 M NaOH for 40 min, transferred to a Hybond-N+ membrane (GE Healthcare) for ∼18 h, and then cross-linked to the membrane using UV light. The membrane was prehybridized, probed with a digoxigenin (DIG)-labeled probe for the N gene, and washed, and detection was performed according to the instructions for the DIG-High Prime DNA labeling and detection starter kit II (Roche).

RT-PCR of leader-containing transcripts.

Intracellular RNA was isolated from wtWIV1. A forward primer (Leader-F) located in the leader sequence, along with various reverse primers located in several ORFs, was used for amplifying leader-containing sequences (primer sequences are available upon request). Leader-containing amplicons were sequenced with the corresponding reverse primers.

ORFX subcellular location.

HeLa cells were transfected with an ORFX-expressing plasmid and cotransfected with organelle markers expressing plasmid SecG1β-GFP, B4Gal-Ti-RFP, or Mito-YFP. After 24 h, the cells were fixed and stained with a mouse anti-HA IgG (Promoter). A Cy3-conjugated goat anti-mouse IgG (Promoter) was used for secondary detection in cells expressing ER or mitochondrial markers. A fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Promoter) was used for secondary detection in cells expressing the Golgi marker. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). Staining patterns were examined with an Olympus Fluoview upright confocal microscope (Olympus).

Luciferase assays and quantitative PCR.

For the ORFX-mediated IFN promoter assay, 293T cells were seeded in 12-well plates and cotransfected with empty vector plasmid pCAGGS, plasmid pCAGGS-NS1, or increasing amounts (100, 200, 400, 600, and 800 ng) of pCAGGS-ORFX with the indicated reporter plasmids. At 24 h posttransfection, cells were infected with Sendai virus (SeV) (100 hemagglutinin units [HAU]/ml) for 12 h to induce IFN production or were treated with tumor necrosis factor alpha (TNF-α) for 1 h to activate NF-κB. Cell lysates were prepared, and luciferase activity was measured using dual-luciferase assay kits (Promega) according to the manufacturer's instructions.

293T cells were transfected with empty vector, NS1-expressing plasmid, or increasing amounts (100, 300, and 600 ng) of ORFX-expressing plasmid. After 24 h, the cells were infected with SeV (100 HAU/ml). At 12 h postinfection, the cells were lysed. The mRNA was extracted and reverse transcribed with PrimeScript RT master mix (TaKaRa). The expression level of IFN-β mRNA was determined by quantitative PCR using SYBR Premix Ex Taq II (TaKaRa). The GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA was quantified as an inner control. 293T cells were transfected as described above. After 24 h, the cells were treated with TNF-α for 6 h, and the cell RNA was extracted and used for quantification of the expression of IL-8 mRNA. All experiments were performed in triplicate and repeated at least three times. All primer sequences used in the quantitative PCRs are available upon request.

IRF3 translocation assay.

293T cells were transfected with empty vector, NS1, or ORFX-expressing plasmid. After 24 h, IFN regulatory factor 3 (IRF3) nuclear translocation was induced by infecting the cells with SeV for 8 h. The cells were fixed and stained with a rabbit anti-IRF3 polyclonal IgG (Proteintech) and a mouse anti-HA IgG (Promoter). An Alexa Fluor 488-conjugated donkey anti-rabbit IgG (Yeasen) and an Alexa Fluor 555-conjugated donkey anti-mouse IgG (Beyotime) were used to detect IRF3 and ORFX, respectively. The cells transfected with empty vector were stained with a rabbit anti-IRF3 polyclonal IgG and a goat anti-SeV IgG (kindly provided by Lin-Fa Wang, Duke-NUS Graduate Medical School, Singapore) as an indication of infection efficiency. An Alexa Fluor 488-conjugated donkey anti-rabbit IgG and a Cy3-conjugated donkey anti-goat IgG (Promoter) were used to detect IRF3 and SeV, respectively. Nuclei were stained with DAPI.

Quantification of mRNA expression of cytokines in infected Calu-3 cells.

Calu-3 cells grown in 24-well plates were mock infected or infected with rWIV1 or rWIV1-ΔX at an MOI of 5 or with SeV (100 HAU/ml). The cells were lysed at 4, 12, 24, and 30 h postinfection. The mRNA expression levels of IFN-β, IL-6, IL-8, and TNF-α were quantified by quantitative PCRs. The expression of GAPDH mRNA was measured as an internal control. All primer sequences used in the quantitative PCRs are available upon request. The experiment was performed twice.

IFN-β sensitivity assay.

Vero E6 cells were seeded a day in advance. The cells were pretreated with 10, 100, or 1,000 U/ml IFN-β (PBL, Piscataway, NJ) for 24 h, infected with wtWIV1, rWIV1, and rWIV1-ΔX at an MOI of 0.1 PFU/cell, and posttreated with the same amount of IFN-β as used previously. At 24 h postinfection, the viral replication was analyzed by plaque assay. The experiment was performed in triplicate.

Statistics.

The statistical significance of the obtained data was analyzed using a Student t test in GraphPad Prism (GraphPad Software, San Diego, CA). A P value of <0.05 was considered statistically significant. Data are presented as the means ± standard errors of the means (SEM).

RESULTS

Strategy for construction of an infectious WIV1 BAC.


Originally, the genome was split into seven contiguous cDNAs (A to G) (Fig. 1A and ​andC).C). Due to plasmid instability, fragment C was separated into two segments (C1 and C2). Besides three naturally occurring BglI sites (GCCNNNN↓NGGC), four BglI sites were successfully introduced by synonymous mutations in the genome (Fig. 1B). Different asymmetric 3-nt overhangs at the junctions of each two contiguous fragments were created by these BglI sites. The eight fragments were then linked in one direction. A SacII site was added to the 5′ terminus of fragment A. A poly(A) sequence (25 nt) and an AscI site were added to the 3′ terminus of fragment G. A naturally occurring BglI site at nucleotide 1571 was removed by the synonymous mutation C1575A (Fig. 1B). Other unexpected synonymous mutations also occurred, including T1422C, T12984C, T14213C, T17130C, C17934T, and T26068G.

The plasmid pBAC-CMV was constructed by inserting the cytomegalovirus (CMV) promoter, hepatitis delta virus (HDV) ribozyme, and bovine growth hormone (BGH) transcription terminal signal sequences into pBeloBAC11, along with the introduction of the SacII and AscI sites between the CMV promoter and HDV ribozyme (Fig. 1C). The eight genomic fragments were inserted into pBAC-CMV in one step. Recombinant viruses could be rescued by direct transfection with the BAC constructs.

Rescue of recombinant viruses.

To rescue recombinant WIV1 (rWIV1), fragments A and G were digested with SacII and AscI, respectively. Following calf intestinal alkaline phosphatase (CIAP) dephosphorylation, the two fragments, along with fragments B to F, were digested using BglI and inserted into pBAC-CMV between SacII and AscI sites in one step. The constructed clone (pBAC-CMV-rWIV1) was transfected into Vero E6 cells. A cytopathic effect was observed at 72 h posttransfection. The one ablated natural BglI site and four introduced BglI sites in the rescued viral genome were confirmed by restriction fragment length polymorphism (RFLP) analysis with BglI digestion (Fig. 2A). Using this method, we also rescued an ORFX deletion mutant virus (rWIV1-ΔX) (Fig. 2B, lane 2) and a mutant with a GFP sequence placed in the coding region of ORFX (rWIV1-GFP-ΔX) (Fig. 3A).

Image
FIG 2. Recovery and characterization of recombinant viruses. (A) Restriction fragment length polymorphism. Amplicons flanking five mutated sites of wild-type and recombinant viruses were digested by BglI. The first amplicon (F1) of wild-type virus can be digested by BglI, and its other four amplicons (F2 to F5) cannot be. In contrast, for amplicons of rWIV1, the first amplicon (F1) cannot be digested by BglI and its other four amplicons (F2 to F5) can be. Lane M, DL2000 DNA ladder (TaKaRa). (B) Detection of viral genomic transcription and replication by Northern blotting. Vero E6 cells were infected with wild-type or recombinant viruses, and intracellular RNA was extracted for Northern blot analysis. Lane 1, wtWIV1; lane 2, rWIV1-ΔX; lane 3, rWIV1; lane 4, uninfected control. (C) Growth kinetics of wild-type and recombinant viruses. Vero E6 cells were infected with wtWIV1 (■), rWIV1 (♢), or rWIV1-ΔX (▲) at an MOI of 1.0 or 0.1 PFU/cell. Cell supernatants were taken at the indicated time points postinfection, and virus titers were determined by plaque assay in Vero E6 cells.

Image
FIG 3. Expression and subcellular location of ORFX protein. (A) The open reading frame of ORFX was replaced by the GFP sequence, and the recombinant virus was rescued. Vero E6 cells were infected with the recombinant virus or mock infected. Green fluorescence was visualized at 24 h postinfection. (B) ORFX protein with an HA tag at the C terminus was expressed in HeLa cells, along with SecG1β-GFP (ER marker), Mito-YFP (mitochondria marker), or B4Gal-Ti-RFP (Golgi marker). The cells were fixed after 24 h and stained with a mouse anti-HA IgG. A Cy3-conjugated goat anti-mouse IgG was used for secondary detection in cells expressing an ER or mitochondrial marker. An FITC-conjugated goat anti-mouse IgG was used for secondary detection in cells expressing a Golgi marker. ORFX protein showed a cytoplasmic distribution and colocalized with the ER maker SecG1β.

ORFX is a functional gene not essential for virus replication.

The one-step growth curves for the two rescued recombinant viruses (rWIV1-ΔX and rWIV1) and wild-type WIV1 (wtWIV1) determined by plaque assay showed that rWIV1-ΔX and rWIV1 both replicated to titers close to those of wild-type virus (Fig. 2C). The expected set of appropriately sized 10 sgRNAs, including sgRNA7 (ORFX), were observed in Northern blot analysis in cells infected with wtWIV1 and rWIV1 (Fig. 2B, lanes 1 and 3). As expected, sgRNA7 was not observed in rWIV1-ΔX infected cells (Fig. 2B, lane 2). Analysis of leader-containing sequences indicated that all 10 sgRNAs in wtWIV1 share an identical core sequence, ACGAAC (Table 1), which further confirmed that ORFX is expressed as sgRNA7. The fact that GFP was expressed in rWIV1-GFP-ΔX-infected cells further confirmed that the open reading frame of ORFX could be expressed (Fig. 3A). Subcellular location analyses showed that the ORFX protein colocalized with the ER marker but not with the Golgi and mitochondrial markers (Fig. 3B).

TABLE 1: Leader-containing sequences of sgRNAs

sgRNA / ORF(s) / Leader-containing sequencea / Consensus sequence positions


1 / 1a/b / GTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT / 67–72
2 / S / GTAGATCTGTTCTCTAAACGAACATGAAATTGTTA / 21486–21491
3 / 3a/b / GTAGATCTGTTCTCTAAACGAACTTATGGATTTGT / 25263–25268
4 / E / GTAGATCTGTTCTCTAAACGAACTTATGTACTCAT / 26112–26117
5 / M / GTAGATCTGTTCTCTAAACGAACTAACTATTATTA / 26351–26356
6 / 6 / GTAGATCTGTTCTCTAAACGAACGCTTTCTTATTA / 26916–26921
7 / X / GTAGATCTGTTCTCTAAACGAACCACTATGTTACT / 27272–27277
8 / 7a/b / GTAGATCTGTTCTCTAAACGAACATGAAAATTATT / 27794–27799
9 / 8 / GTAGATCTGTTCTCTAAACGAACATGAAACTTCTC / 28300–28305
10 / N / GTAGATCTGTTCTCTAAACGAACAAACTAAAATGT / 28672–28677
aThe consensus sequence is in bold. Underlining indicates the initiation codon.


ORFX protein inhibits production of IFN-β.

To determine whether ORFX inhibits the induction of IFN, 293T cells were transfected with plasmids pIFNβ-Luc and pRL-TK and a plasmid expressing ORFX, influenza virus strain PR8 NS1 (positive control), or empty vector (negative control). As expected, SeV activated IFN production in cells transfected with empty vector. The positive control, influenza virus NS1 protein dramatically inhibited the expression from the IFN promoter. ORFX protein exhibited an inhibition effect, but the effect decreased when more ORFX protein was expressed (Fig. 4A). Similar results were observed for IFN-β mRNA quantification (Fig. 4B and ​andCC).

Image
FIG 4. ORFX protein inhibits the production of type I interferon. (A and B) 293T cells seeded in 12-well plates were transfected with 100 ng pIFN-β-Luc, 5 ng pRL-TK, empty vector, an influenza A NS1-expressing plasmid, or increasing doses (100, 200, 400, 600, and 800 ng) of an ORFX-expressing plasmid. Empty vector was added appropriately to ensure that cells in each well were transfected with the same amount of plasmids. The cells were infected with Sendai virus (100 hemagglutinating units/ml) at 24 h posttransfection. Samples were collected at 12 h postinfection, followed by dual-luciferase assay. The results were expressed as the firefly luciferase value normalized to that of Renilla luciferase. The relative expression of IFN-β mRNA was determined by quantitative RT-PCR and normalized to the expression level of GAPDH mRNA. (C) The expression of the NS1 and ORFX proteins was analyzed by Western blotting with an antibody against HA tag. The experiments were replicated three times. (D and E) For the IRF3 translocation assay, 293T cells were transfected with empty vector-, NS1-, or ORFX-expressing plasmid. After 24 h, the cells were infected with Sendai virus to induce IRF3 nuclear translocation. The cells were fixed at 8 h postinfection and stained with anti-HA IgG. A goat anti-Sendai virus polyclonal IgG was used to stain the cells transfected with empty vector. A rabbit anti-IRF3 polyclonal IgG was used to label IRF3. The white arrow indicates IRF3 nuclear translocation. The relative IRF3 translocation ratios were calculated for each group by counting the number of IRF3 nuclear translocation cells (randomly selected from at least 4 fields) and dividing by the total number of infected or transfected cells. The IRF3 nuclear translocation efficiency of each group was expressed as the percentage of their relative IRF3 translocation ratios to that of the control (cells transfected with empty vector). (F) Calu-3 cells were mock infected or infected with rWIV1 or rWIV1-ΔX (MOI of 5) or SeV (100 HAU/ml). At 4, 12, 24, and 30 h postinfection, the cell RNA was extracted and used for quantitative RT-PCR of the expression level of IFN-β mRNA. The experiment was performed in triplicate and replicated twice. (G) Vero E6 cells were pretreated with indicated amount of IFN-β, infected with wtWIV1, rWIV1, or rWIV1-ΔX at an MOI of 0.1 PFU/cell, and posttreated with IFN-β. Viral replication was analyzed at 24 h postinfection by plaque assay. The experiment was performed in triplicate and replicated twice. The differences between selected groups were significant, with P values of less than 0.05, as follows: 0.0049 (*; bars 4 and 6 in panel A), 0.0008 (**; bars 6 and 7 in panel A), 0.0072 (*; bars 4 and 6 in panel B), 0.018 (*; bars for rWIV1 and rWIV1-ΔX in panel F), and <0.0001 (*** in panel G).

An IRF3 nuclear translocation assay was performed to see whether ORFX protein inhibits IFN production through inhibiting this process. 293T cells were transfected with an empty vector-, NS1-, or ORFX-expressing plasmid. After 24 h, IRF3 nuclear translocation was induced by infection with SeV for 8 h. The relative IRF3 translocation ratios were calculated for each group by counting the number of the IRF3 nuclear translocation cells (randomly selected from at least 4 fields) divided by the number of total infected or transfected cells. The IRF3 nuclear translocation efficiency of each group was expressed as the percentage of their relative IRF3 translocation ratios to that of the control (cells transfected with empty vector). As expected, NS1 strongly inhibited translocation of IRF3, while ORFX protein also showed inhibition of IRF3 translocation but less efficiently (Fig. 4D and ​andEE).

To further investigate the IFN inhibition activity of ORFX, the deletion mutant and wild-type recombinant virus were used to infect Calu-3 cells at an MOI of 5. Mock-infected cells were used as negative control. Calu-3 cells infected with SeV were used as positive control. Samples were collected at 4, 12, 24, and 30 h postinfection. The relative expression of IFN-β mRNA was determined by quantitative PCR and normalized to the expression of GAPDH mRNA. Compared to SeV, WIV1 recombinants induced low levels of IFN-β mRNA in Calu-3 cells (Fig. 4F). The ORFX deletion mutant induced a significantly higher level of IFN-β mRNA than wild-type recombinant virus in infected cells at 12 h postinfection, but there were no significant differences at 24 and 30 h postinfection (Fig. 4F). These results indicate that ORFX protein may play a role in antagonizing IFN only at early times during WIV1 infection.

An ORFX deletion mutant shows increased sensitivity to IFN-β.

To further investigate the effect of ORFX on the viral sensitivity of IFN, we tested the replication efficiencies of wtWIV1, rWIV1, and rWIV1-ΔX in Vero E6 cells which were pretreated and posttreated with IFN-β. The replication of rWIV1-ΔX was inhibited and reduced by ∼0.5 log compared to that of wtWIV1 and rWIV1 at concentrations of 10 and 100 U/ml IFN-β (Fig. 4G), whereas at a higher IFN-β concentration (1,000 U/ml), the rWIV1-ΔX titers did not show an obvious decrease compared to those of wild-type virus. We expected that the ORFX deletion mutant would replicate less efficiently than the wild-type virus in IFN-competent cells. However, we did not find a significant difference when we grew the two viruses in Calu-3 and HeLa-hACE2 cells, even at a very low MOI of 0.001 (Fig. 5).

Image
FIG 5. Comparison of viral replication efficiencies of rWIV1-ΔX and rWIV1 in IFN-competent cells. Calu-3 (A) and HeLa-hACE2 (B) cells were infected with rWIV1 or rWIV1-ΔX at an MOI of 0.001. Samples were collected at 0, 12, 24, 36, 48, 72, 96, and 120 h postinfection. The viral titers were measured by plaque assay.

ORFX protein activates NF-κB.

NF-κB plays an important role in regulating the immune response to viral infection and is also a key factor frequently targeted by viruses for taking over the host cell (27). Several proteins (Nsp1, N, and 3a) encoded by SARS-CoV have activities in both IFN antagonism and NF-κB activation (28). In this study, we also tested whether ORFX protein could activate NF-κB. 293T cells were transfected with pNF-κB-Luc, pRL-TK, empty vector, NS1, or increasing amounts (200, 400, and 600 ng) of ORFX expressing plasmid. After 24 h, the cells were mock treated or treated with TNF-α for 6 h, and luciferase activity was determined. ORFX protein obviously activated NF-κB, no matter whether the cells were treated with TNF-α or not (Fig. 6A), whereas IL-8 was upregulated only when the cells were treated with TNF-α (Fig. 6B). However, no significant difference was observed for IL-6 and IL-8 transcription levels between the rWIV1-ΔX- and rWIV1-infected Calu-3 cells (Fig. 6C and ​andD).D). A significant difference was observed only for the induction of TNF-α mRNA at the late time of virus infection, when the ORFX deletion mutant induced less TNF-α mRNA (Fig. 6E).

Image
FIG 6. ORFX protein activates NF-κB. 293T cells were transfected with 100 ng pNF-κB-Luc, 10 ng pRL-TK, empty vector, an NS1-expressing plasmid, or increasing amounts (200, 400, and 600 ng) of an ORFX-expressing plasmid. After 24 h, the cells were treated with TNF-α. (A) Dual-luciferase activity was determined after 6 h. The results were expressed as the firefly luciferase activity normalized to that of Renilla luciferase. (B) The relative expression of IL-8 mRNA was quantified through quantitative RT-PCR and normalized to that of GAPDH mRNA. Differences between selected groups were significant, with P value less than 0.05, as follows: <0.0001 (***; bars 1 and 3 in panel A), 0.0339 (*; bars 4 and 7 in panel A), and 0.0002 (***; bars 4 and 6 in panel B). n.s., not significant. The experiments were performed three times. (C to E) The RNA extracted from Calu-3 cells for Fig. 4 was used for quantification of the expression of IL-6 (C), IL-8 (D), and TNF-α (E) mRNAs.

DISCUSSION

In this study, we have developed a fast and cost-effective method for reverse genetics of coronaviruses by combining two approaches developed by others (29, 30). Our method allows the genomes of coronaviruses to be split into multiple fragments and inserted into a BAC plasmid with a single step. Recombinant viruses can then be efficiently rescued by direct transfection of the BAC constructs. As the genomes can be divided into multiple short fragments, mutations can be introduced into individual fragments easily (31). Using this method, we successfully rescued three recombinant viruses derived from SL-CoV WIV1 (rWIV1, rWIV1-ΔX, and rWIV1-GFP-ΔX). The recombinant rWIV1 and rWIV1-ΔX replicated to titers close to those of wtWIV1 in Vero E6 cells (Fig. 2C), suggesting that the deletion of ORFX did not affect WIV1 replication in vitro. Northern blotting and fluorescence microscopy further confirmed that ORFX is transcribed as sgRNA7 and translated in virus-infected cells. These results demonstrated that the unique ORFX in SL-CoV WIV1 is a functional gene but is not essential for virus replication. We propose that the ORFX sgRNA is the template for the translation of a novel 11-kDa accessory protein of WIV1, bringing the total number of group-specific accessory proteins to ten.

In previous studies, it has been proved that SARS-CoV group-specific accessory genes ORF3b and ORF6 inhibit host IFN production and/or signaling during virus infection and contribute to viral pathogenesis (20). It is interesting to know whether the ORFX has a similar function in antagonizing IFN. In this study, ORFX protein showed an inhibitory effect on IFN production, but the effect decreased when more ORFX protein was expressed (Fig. 4A and ​andB).B). Moreover, the ORFX deletion mutant had a significantly lower inhibitory effect on IFN production than wild-type recombinant virus in infected Calu-3 cells, but only at an early time after infection (Fig. 4F). Furthermore, the IFN sensitivity assay indicated that the ORFX deletion mutant was more sensitive to IFN-β (Fig. 4G), suggesting that ORFX protein may participate in subverting the antiviral state stimulated by IFN-β. All these results suggested that ORFX participates in the modulation of the IFN response. Previous studies showed that SARS-CoV ORF3a and ORF7a activate NF-κB and upregulate IL-8 and CCL5 production (22, 23). In our study, we also found through a dual-luciferase assay that overexpressed ORFX can activate NF-κB (Fig. 6A). Furthermore, the level of TNF-α mRNA induced by wild-type recombinant virus was significantly higher than that induced by the ORFX deletion mutant, but only at the late stage of infection (Fig. 6E). These results indicated that ORFX also participates in activation of NF-κB. We noted that the IFN inhibition activity of ORFX was not dose dependent and decreased when there was more ORFX expression. One possible hypothesis is that ORFX inhibits IFN only at the early stage of infection. At the late stage, it activates NF-κB, which in turn stimulate IFN expression, and this leads to the attenuation of its IFN antagonist activity.

Coronavirus was previously shown to induce the unfolded-protein response (UPR) and ER stress in infected cell culture (32). Normally, ER is an active organelle for protein folding and modification. Loss of protein folding homeostasis would cause ER stress and induce the UPR, leading to the activation of three ER stress transducers. These transducers work in concert to attenuate translation and improve ER folding capacity to restore ER homeostasis (33). In this process, NF-κB is activated, and apoptosis will be induced if ER stress is prolonged (32, 33). In this study, we observed that the overexpression of ORFX protein led to cell death and the decrease of Renilla values (data not shown). This may imply that ORFX has a cytotoxic effect and an influence on overall protein translation. We also found that ORFX colocalizes with an ER marker. We hypothesize that ORFX may induce the UPR and cause ER stress which would activate NF-κB and induce apoptosis, promoting viral release at the late stage of infection.

It should be noted that the IFN and NF-κB detection systems used in this study were derived from and used in human cells. Since the innate immune system of bats is special and probably deficient in some aspects compared to the human system (34), it will be interesting to conduct the same studies in bat cells to determine whether ORFX protein has the same profiles as those observed in the human cell system. The development of different cell lines from the Rhinolophus bat, which is the reservoir host of SL-CoV, will facilitate this research in the future.

ACKNOWLEDGMENTS

We thank Hanzhong Wang, Zhenhua Zheng, Xianliang Ke, and Jin Meng (Research Group of Zoonotic Diseases, Wuhan Institute of Virology, CAS, China) for help and discussion, Yanyi Wang (Research Group of Molecular Immunology, Wuhan Institute of Virology, CAS, China) for kindly providing plasmids expressing cellular organelle markers (SecG1β-GFP, B4Gal-Ti-RFP, and Mito-YFP), Lin-Fa Wang (Duke-NUS Graduate Medical School, Singapore) for kindly providing a goat anti-SeV IgG, and Cecilia Waruhiu for language help.

This work was jointly funded by the National Natural Science Foundation of China (81290341, 31321001, and 81401672) and the National Institutes of Health (NIAID R01AI110964).


REFERENCES

1. Peiris JSM, Lai ST, Poon LLM, Guan Y, Yam LYC, Lim W, Nicholls J, Yee WKS, Yan WW, Cheung MT, Cheng VCC, Chan KH, Tsang DNC, Yung RWH, Ng TK, Yuen KY. 2003. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 361:1319–1325. doi:10.1016/S0140-6736(03)13077-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
2. Ge XY, Li JL, Yang XL, Chmura AA, Zhu G, Epstein JH, Mazet JK, Hu B, Zhang W, Peng C, Zhang YJ, Luo CM, Tan B, Wang N, Zhu Y, Crameri G, Zhang SY, Wang LF, Daszak P, Shi ZL. 2013. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature 503:535–538. doi:10.1038/nature12711. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
3. Yuan J, Hon CC, Li Y, Wang D, Xu G, Zhang H, Zhou P, Poon LL, Lam TT, Leung FC, Shi Z. 2010. Intraspecies diversity of SARS-like coronaviruses in Rhinolophus sinicus and its implications for the origin of SARS coronaviruses in humans. J Gen Virol 91:1058–1062. doi:10.1099/vir.0.016378-0. [PubMed] [CrossRef] [Google Scholar]
4. Drexler JF, Gloza-Rausch F, Glende J, Corman VM, Muth D, Goettsche M, Seebens A, Niedrig M, Pfefferle S, Yordanov S, Zhelyazkov L, Hermanns U, Vallo P, Lukashev A, Muller MA, Deng H, Herrler G, Drosten C. 2010. Genomic characterization of severe acute respiratory syndrome-related coronavirus in European bats and classification of coronaviruses based on partial RNA-dependent RNA polymerase gene sequences. J Virol 84:11336–11349. doi:10.1128/JVI.00650-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
5. Tong S, Conrardy C, Ruone S, Kuzmin IV, Guo X, Tao Y, Niezgoda M, Haynes L, Agwanda B, Breiman RF, Anderson LJ, Rupprecht CE. 2009. Detection of novel SARS-like and other coronaviruses in bats from Kenya. Emerg Infect Dis 15:482–485. doi:10.3201/eid1503.081013. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
6. Lau SKP, Woo PCY, Li KSM, Huang Y, Tsoi HW, Wong BHL, Wong SSY, Leung SY, Chan KH, Yuen KY. 2005. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci U S A 102:14040–14045. doi:10.1073/pnas.0506735102. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Li WH, Zhang CS, Sui JH, Kuhn JH, Moore MJ, Luo SW, Wong SK, Huang IC, Xu KM, Vasilieva N, Murakami A, He YQ, Marasco WA, Guan Y, Choe HY, Farzan M. 2005. Receptor and viral determinants of SARS-coronavirus adaptation to human ACE2. EMBO J 24:1634–1643. doi:10.1038/sj.emboj.7600640. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
8. He B, Zhang Y, Xu L, Yang W, Yang F, Feng Y, Xia L, Zhou J, Zhen W, Feng Y, Guo H, Zhang H, Tu C. 2014. Identification of diverse alphacoronaviruses and genomic characterization of a novel severe acute respiratory syndrome-like coronavirus from bats in China. J Virol 88:7070–7082. doi:10.1128/JVI.00631-14. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Ren W, Li W, Yu M, Hao P, Zhang Y, Zhou P, Zhang S, Zhao G, Zhong Y, Wang S, Wang LF, Shi Z. 2006. Full-length genome sequences of two SARS-like coronaviruses in horseshoe bats and genetic variation analysis. J Gen Virol 87:3355–3359. doi:10.1099/vir.0.82220-0. [PubMed] [CrossRef] [Google Scholar]
10. Yang XL, Hu B, Wang B, Wang MN, Zhang Q, Zhang W, Wu LJ, Ge XY, Zhang YZ, Daszak P, Wang LF, Shi ZL. 2015. Isolation and characterization of a novel bat coronavirus closely related to the direct progenitor of severe acute respiratory syndrome coronavirus. J Virol 90:3253–3256. [PMC free article] [PubMed] [Google Scholar]
11. Lau SK, Li KS, Huang Y, Shek CT, Tse H, Wang M, Choi GK, Xu H, Lam CS, Guo R, Chan KH, Zheng BJ, Woo PC, Yuen KY. 2010. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J Virol 84:2808–2819. doi:10.1128/JVI.02219-09. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Menachery VD, Yount BL Jr, Debbink K, Agnihothram S, Gralinski LE, Plante JA, Graham RL, Scobey T, Ge XY, Donaldson EF, Randell SH, Lanzavecchia A, Marasco WA, Shi ZL, Baric RS. 2015. A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence. Nat Med 21:1508–1513. doi:10.1038/nm.3985. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. Menachery VD, Yount BL Jr, Sims AC, Debbink K, Agnihothram SS, Gralinski LE, Graham RL, Scobey T, Plante JA, Royal SR, Swanstrom J, Sheahan TP, Pickles RJ, Corti D, Randell SH, Lanzavecchia A, Marasco WA, Baric RS. 2016. SARS-like WIV1-CoV poised for human emergence. Proc Natl Acad Sci U S A doi:10.1073/pnas.1517719113. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. de Groot R, Baker S, Baric R, Enjuanes L, Gorbalenya A, Holmes K, Perlman S, Poon L, Rottier P, Talbot P, Woo P, Ziebuhr J. 2012. Family Coronaviridae, p 806–828. In King A, Adams M, Cartens E, Lefkowitz E (ed), Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, CA. [Google Scholar]
15. Woo PC, Lau SK, Lam CS, Lau CC, Tsang AK, Lau JH, Bai R, Teng JL, Tsang CC, Wang M, Zheng BJ, Chan KH, Yuen KY. 2012. Discovery of seven novel mammalian and avian coronaviruses in the genus Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. J Virol 86:3995–4008. doi:10.1128/JVI.06540-11. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
16. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Penaranda S, Bankamp B, Maher K, Chen MH, Tong SX, Tamin A, Lowe L, Frace M, DeRisi JL, Chen Q, Wang D, Erdman DD, Peret TCT, Burns C, Ksiazek TG, Rollin PE, Sanchez A, Liffick S, Holloway B, Limor J, McCaustland K, Olsen-Rasmussen M, Fouchier R, Gunther S, Osterhaus ADME, Drosten C, Pallansch MA, Anderson LJ, Bellini WJ. 2003. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 300:1394–1399. doi:10.1126/science.1085952. [PubMed] [CrossRef] [Google Scholar]
17. Li WD, Shi ZL, Yu M, Ren WZ, Smith C, Epstein JH, Wang HZ, Crameri G, Hu ZH, Zhang HJ, Zhang JH, McEachern J, Field H, Daszak P, Eaton BT, Zhang SY, Wang LF. 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science 310:676–679. doi:10.1126/science.1118391. [PubMed] [CrossRef] [Google Scholar]
18. Yount B, Roberts RS, Sims AC, Deming D, Frieman MB, Sparks J, Denison MR, Davis N, Baric RS. 2005. Severe acute respiratory syndrome coronavirus group-specific open reading frames encode nonessential functions for replication in cell cultures and mice. J Virol 79:14909–14922. doi:10.1128/JVI.79.23.14909-14922.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
19. Liu DX, Fung TS, Chong KK-L, Shukla A, Hilgenfeld R. 2014. Accessory proteins of SARS-CoV and other coronaviruses. Antiviral Res 109:97–109. doi:10.1016/j.antiviral.2014.06.013. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
20. Kopecky-Bromberg SA, Martinez-Sobrido L, Frieman M, Baric RA, Palese P. 2007. Severe acute respiratory syndrome coronavirus open reading frame (ORF) 3b, ORF 6, and nucleocapsid proteins function as interferon antagonists. J Virol 81:548–557. doi:10.1128/JVI.01782-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
21. Minakshi R, Padhan K, Rani M, Khan N, Ahmad F, Jameel S. 2009. The SARS coronavirus 3a protein causes endoplasmic reticulum stress and induces ligand-independent downregulation of the type 1 interferon receptor. PLoS One 4:e8342. doi:10.1371/journal.pone.0008342. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
22. Obitsu S, Ahmed N, Nishitsuji H, Hasegawa A, Nakahama K, Morita I, Nishigaki K, Hayashi T, Masuda T, Kannagi M. 2009. Potential enhancement of osteoclastogenesis by severe acute respiratory syndrome coronavirus 3a/X1 protein. Arch Virol 154:1457–1464. doi:10.1007/s00705-009-0472-z. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Kanzawa N, Nishigaki K, Hayashi T, Ishii Y, Furukawa S, Niiro A, Yasui F, Kohara M, Morita K, Matsushima K, Le MQ, Masuda T, Kannagi M. 2006. Augmentation of chemokine production by severe acute respiratory syndrome coronavirus 3a/X1 and 7a/X4 proteins through NF-kappaB activation. FEBS Lett 580:6807–6812. doi:10.1016/j.febslet.2006.11.046. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
24. Zhou P, Li H, Wang H, Wang LF, Shi Z. 2012. Bat severe acute respiratory syndrome-like coronavirus ORF3b homologues display different interferon antagonist activities. J Gen Virol 93:275–281. doi:10.1099/vir.0.033589-0. [PubMed] [CrossRef] [Google Scholar]
25. Ren W, Qu X, Li W, Han Z, Yu M, Zhou P, Zhang SY, Wang LF, Deng H, Shi Z. 2008. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. J Virol 82:1899–1907. doi:10.1128/JVI.01085-07. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Perrotta AT, Been MD. 1991. A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature 350:434–436. doi:10.1038/350434a0. [PubMed] [CrossRef] [Google Scholar]
27. Santoro MG, Rossi A, Amici C. 2003. NF-kappaB and virus infection: who controls whom. EMBO J 22:2552–2560. doi:10.1093/emboj/cdg267. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
28. DeDiego ML, Nieto-Torres JL, Jimenez-Guardeño JM, Regla-Nava JA, Castaño-Rodriguez C, Fernandez-Delgado R, Usera F, Enjuanes L. 2014. Coronavirus virulence genes with main focus on SARS-CoV envelope gene. Virus Res 194:124–137. doi:10.1016/j.virusres.2014.07.024. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
29. Almazan F, Gonzalez JM, Penzes Z, Izeta A, Calvo E, Plana-Duran J, Enjuanes L. 2000. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci U S A 97:5516–5521. doi:10.1073/pnas.97.10.5516. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
30. Yount B, Curtis KM, Baric RS. 2000. Strategy for systematic assembly of large RNA and DNA genomes: transmissible gastroenteritis virus model. J Virol 74:10600–10611. doi:10.1128/JVI.74.22.10600-10611.2000. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
31. Donaldson EF, Sims AC, Baric RS. 2008. Systematic assembly and genetic manipulation of the mouse hepatitis virus A59 genome. Methods Mol Biol 454:293–315. doi:10.1007/978-1-59745-181-9_21. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
32. Fung TS, Liu DX. 2014. Coronavirus infection, ER stress, apoptosis and innate immunity. Front Microbiol 5:296. doi:10.3389/fmicb.2014.00296. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
33. Chaudhari N, Talwar P, Parimisetty A, Lefebvre d' Hellencourt C, Ravanan P. 2014. A molecular web: endoplasmic reticulum stress, inflammation, and oxidative stress. Front Cell Neurosci 8:213. doi:10.3389/fncel.2014.00213. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
34. Baker ML, Schountz T, Wang LF. 2013. Antiviral immune responses of bats: a review. Zoonoses Public Health 60:104–116. doi:10.1111/j.1863-2378.2012.01528.x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 7:12 am

Part 1 of 2

Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus
by Ben Hu, Data curation, Formal analysis, Investigation, Validation, Visualization, Writing – original draft,#1 Lei-Ping Zeng, Investigation, Methodology, Xing-Lou Yang, Investigation, Resources, Xing-Yi Ge, Formal analysis, Resources, Wei Zhang, Investigation, Bei Li, Investigation, Jia-Zheng Xie, Investigation, Xu-Rui Shen, Investigation, Yun-Zhi Zhang, Resources, Ning Wang, Investigation,1 Dong-Sheng Luo, Investigation, Resources,1 Xiao-Shuang Zheng, Investigation, Mei-Niang Wang, Resources,1 Peter Daszak, Funding acquisition, Writing – review & editing, Lin-Fa Wang, Conceptualization, Funding acquisition, Writing – review & editing, Jie Cui, Conceptualization, Formal analysis, Funding acquisition, Software, Writing – review & editing, and Zheng-Li Shi, Conceptualization, Funding acquisition, Methodology, Project administration, Supervision, Visualization, Writing – review & editing
Christian Drosten, Editor
Copyright © 2017 Hu et al

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


There have been three publications, in 2015,30 2016 and 2017, describing the WIV gain of function research. The WIV, having learned both basic and traceless infectious-clone technology from joint research with a laboratory at the University of North Carolina (UNC) in 2015, initiated construction of novel chimeric coronaviruses without UNC immediately thereafter. WIV’s first publication on the use of basic infectious-clone technology to construct novel chimeric coronaviruses at WIV appeared in 2016.31 WIV’s first publication on the use of traceless, signature-free infectious-clone technology also appeared in 2016.32

-- Did the SARS-CoV-2 virus arise from a bat coronavirus research program in a Chinese laboratory? Very possibly, by Milton Leitenberg


Abstract

A large number of SARS-related coronaviruses (SARSr-CoV) have been detected in horseshoe bats since 2005 in different areas of China. However, these bat SARSr-CoVs show sequence differences from SARS coronavirus (SARS-CoV) in different genes (S, ORF8, ORF3, etc) and are considered unlikely to represent the direct progenitor of SARS-CoV. Herein, we report the findings of our 5-year surveillance of SARSr-CoVs in a cave inhabited by multiple species of horseshoe bats in Yunnan Province, China. The full-length genomes of 11 newly discovered SARSr-CoV strains, together with our previous findings, reveals that the SARSr-CoVs circulating in this single location are highly diverse in the S gene, ORF3 and ORF8. Importantly, strains with high genetic similarity to SARS-CoV in the hypervariable N-terminal domain (NTD) and receptor-binding domain (RBD) of the S1 gene, the ORF3 and ORF8 region, respectively, were all discovered in this cave. In addition, we report the first discovery of bat SARSr-CoVs highly similar to human SARS-CoV in ORF3b and in the split ORF8a and 8b. Moreover, SARSr-CoV strains from this cave were more closely related to SARS-CoV in the non-structural protein genes ORF1a and 1b compared with those detected elsewhere. Recombination analysis shows evidence of frequent recombination events within the S gene and around the ORF8 between these SARSr-CoVs. We hypothesize that the direct progenitor of SARS-CoV may have originated after sequential recombination events between the precursors of these SARSr-CoVs. Cell entry studies demonstrated that three newly identified SARSr-CoVs with different S protein sequences are all able to use human ACE2 as the receptor, further exhibiting the close relationship between strains in this cave and SARS-CoV. This work provides new insights into the origin and evolution of SARS-CoV and highlights the necessity of preparedness for future emergence of SARS-like diseases.

Author summary

Increasing evidence has been gathered to support the bat origin of SARS coronavirus (SARS-CoV) in the past decade. However, none of the currently known bat SARSr-CoVs is thought to be the direct ancestor of SARS-CoV. Herein, we report the identification of a diverse group of bat SARSr-CoVs in a single cave in Yunnan, China. Importantly, all of the building blocks of SARS-CoV genome, including the highly variable S gene, ORF8 and ORF3, could be found in the genomes of different SARSr-CoV strains from this single location. Based on the analysis of full-length genome sequences of the newly identified bat SARSr-CoVs, we speculate that the direct ancestor of SARS-CoV may have arisen from sequential recombination events between the precursors of these bat SARSr-CoVs prior to spillover to an intermediate host. In addition, we found bat SARSr-CoV strains with different S proteins that can all use the receptor of SARS-CoV in humans (ACE2) for cell entry, suggesting diverse SARSr-CoVs capable of direct transmission to humans are circulating in bats in this cave. Our current study therefore offers a clearer picture on the evolutionary origin of SARS-CoV and highlights the risk of future emergence of SARS-like diseases.

Introduction

Severe Acute Respiratory Syndrome (SARS) is a severe emerging viral disease with high fatality characterized by fever, headache and severe respiratory symptoms including cough, dyspnea and pneumonia [1]. Due to its high transmissibility among humans, after its first emergence in southern China in late 2002, it rapidly led to a global pandemic in 2003 and was marked as one of the most significant public health threats in the 21st century [2,3]. The causative agent, SARS coronavirus (SARS-CoV), has been previously assigned to group 2b CoV and is now a member of the lineage B of genus Betacoronavirus in the family Coronaviridae [4]. It shares similar genome organization with other coronaviruses, but exhibits a unique genomic structure which includes a number of specific accessory genes, including ORF3a, 3b, ORF6, ORF7a, 7b, ORF8a, 8b and 9b [5,6].

Masked palm civets (Paguma larvata) were initially hypothesized to be the animal origin of SARS-CoV [7,8]. However, since a large number of genetically diverse SARS-related coronaviruses (SARSr-CoV) have been detected in multiple species of horseshoe bats (genus Rhinolophus) from different areas of China and Europe in the aftermath of SARS, it is prevailingly considered that SARS-CoV originated in horseshoe bats with civets acting as the intermediate amplifying and transmitting host [9–16]. Recently we have reported four novel SARSr-CoVs from Chinese horseshoe bats that shared much higher genomic sequence similarity to the epidemic strains, particularly in their S gene, of which two strains (termed WIV1 and WIV16) have been successfully cultured in vitro [17,18]. These newly identified SARSr-CoVs have been demonstrated to use the same cellular receptor (angiotensin converting enzyme-2 [ACE-2]) as SARS-CoV does and replicate efficiently in primary human airway cells [17–19].

Despite the cumulative evidence for the emergence of SARS-CoV from bats, all bat SARSr-CoVs described so far are clearly distinct from SARS-CoV in the S gene and/or one or more accessory genes such as ORF3 and ORF8, suggesting they are likely not the direct ancestor of SARS-CoV. Thus a critical gap remains in our understanding of how and where SARS-CoV originated from bat reservoirs. Previously, we reported a number of bat SARSr-CoVs with diverse S protein sequences from a single cave in Yunnan Province, including the four strains mentioned above most closely related to SARS-CoV [17,18]. Here we report the latest results of our 5-year longitudinal surveillance of bat SARSr-CoVs in this single location and systematic evolutionary analysis using full-length genome sequences of 15 SARSr-CoV strains (11 novel ones and 4 from previous studies). Efficiency of human ACE2 usage and the functions of accessory genes ORF8 and 8a were also evaluated for some of the newly identified strains.

Results

Continued circulation of diverse SARSr-CoVs in bats from a single location


We have carried out a five-year longitudinal surveillance (April 2011 to October 2015) on SARSr-CoVs in bats from a single habitat in proximity to Kunming city, Yunnan province, China, which was mainly inhabited by horseshoe bats. A total of 602 alimentary specimens (anal swabs or feces) were collected and tested for the presence of CoVs by a Pan-CoV RT-PCR targeting the 440-nt RdRp fragment that is conserved among all known α- and β-CoVs [20]. In total, 84 samples tested positive for CoVs. Sequencing of the PCR amplicons revealed the presence of SARSr-CoVs in the majority (64/84) of the CoV-positive samples (Table 1). Host species identification by amplification of either Cytb or ND1 gene suggested that most (57/64) of the SARSr-CoV positive samples were from Rhinolophus sinicus, while the remaining 7 samples were from Rhinolophus ferrumequinum, Rhinolophus affinis and from Aselliscus stoliczkanus which belongs to the family Hipposideridae.

Table 1: Summary of SARSr-CoV detection in bats from a single habitat in Kunming, Yunnan.

Sampling time / Sample type / Sample Numbers / SARSr-CoV + bat species (No.)

Total CoV + SARSr-CoV +


April, 2011 / anal swab / 14 / 1 / 1 / R. sinicus (1)
October, 2011 / anal swab / 8 / 3 / 3 / R. sinicus (3)
May, 2012 / anal swab & feces / 54 / 9 / 4 / R. sinicus (4)
September, 2012 / feces / 39 / 20 / 19 / R. sinicus (16); R. ferrumequinum (3)
April, 2013 / feces / 52 / 21 / 16 / R. sinicus (16)
July, 2013 / anal swab & feces / 115 / 9 / 8 / R. sinicus (8)
May, 2014 / feces / 131 / 8 / 4 / A. stoliczkamus (3); R. affinis (1)
October, 2014 / anal swab / 19 / 4 / 4 / R. sinicus (4)
May, 2015 / feces / 145 / 3 / 0 / --
October, 2015 / anal swab / 25 / 6 / 5 / R. sinicus (5)
Total / -- / 602 / 84 / 64 / R (61) A (3)


Based on the preliminary analysis of the partial RdRp sequences, all of the 64 bat SARSr-CoV sequences showed high similarity among themselves and with other reported bat SARSr-CoVs and SARS-CoVs from humans and civets. To understand the genetic diversity of these bat SARSr-CoVs, the most variable region of the SARSr-CoV S gene, corresponding to the receptor-binding domain (RBD) of SARS-CoV, were amplified and sequenced. Due to low viral load in some samples, RBD sequences were successfully amplified only from 49 samples. These RBD sequences displayed high genetic diversity and could be divided into two large clades, both of which included multiple genotypes. Clade 1 strains shared an identical size and higher amino acid (aa) sequence identity with SARS-CoV RBD, while clade 2 had a shorter size than SARS-CoV S due to two deletions (5 and 12–13 aa, respectively) (S1 Fig). Co-infections by two strains of different clades were detected in two samples, Rs3262 and Rs4087 (S1 Fig).

Genomic characterization of the novel SARSr-CoVs

Based on the diversity of RBD sequences, 11 novel SARSr-CoV strains named by abbreviation of bat species and sample ID (Rs4081, Rs4084, Rs4231, Rs4237, Rs4247, Rs4255, Rs4874, Rs7327, Rs9401, Rf4092 and As6526) were selected for full-length genomic sequencing based on sample abundance, genotype of RBD as well as sampling time. For each RBD genotype and each time of sampling, at least one representative strain was selected. The genome size of these novel SARSr-CoVs ranged from 29694 to 30291 nucleotides (nt). This gave a total of 15 full-length genomes of bat SARSr-CoVs from this single location (13 from R.sinicus, and one each from R. ferrumequinum and A. stoliczkanus), including our previously reported strains, Rs3367, RsSHC014, WIV1 and WIV16 [17,18]. The genomes of all 15 SARSr-CoVs circulating in this single cave shared 92.0% to 99.9% nt sequence identity. The overall nt sequence identity between these SARSr-CoVs and human and civet SARS-CoVs is 93.2% to 96%, significantly higher than that observed for bat SARSr-CoVs reported from other locations in China (88–93%) [9,10,12,14,21,22]. The genome sequence similarity among the 15 SARSr-CoVs and SARS-CoV SZ3 strain was examined by Simplot analysis (Fig 1). The 15 SARSr-CoVs are highly conserved and share a uniformly high sequence similarity to SARS-CoV in the non-structural gene ORF1a (96.6% to 97.1% nt sequence identity, 98.0% to 98.3% aa sequence identity) and ORF1b (96.1% to 96.6% nt sequence identity, 99.0% to 99.4% aa sequence identity). In contrast, a considerable genetic diversity is shown in the S gene (corresponding to SZ3 genome position 21477 to 25244) and ORF8 (corresponding to SZ3 genome position 27764 to 28132) (Fig 1).

Image
Fig 1. Similarity plot based on the full-length genome sequence of civet SARS CoV SZ3.
Full-length genome sequences of all SARSr-CoV detected in bats from the cave investigated in this study were used as reference sequences. The analysis was performed with the Kimura model, a window size of 1500 base pairs and a step size of 150 base pairs.


The 11 novel SARSr-CoVs identified from this single location generally shared similar genome organization with SARS-CoV and other bat SARSr-CoVs. In our previous study, we identified an additional ORF termed ORFx present between ORF6 and ORF7 in strain WIV1 and WIV16 [18,23]. In this study, ORFx was also found in the genomes of Rs7327 and Rs4874. Compared with that of WIV1 and WIV16, the length of ORFx in Rs7327 and Rs4874 was extended to 510 nt due to a deletion of 2 nt in a poly-T sequence that resulted in a shift of reading frame (Fig 2 and S2 Fig).

Image
Fig 2. Schematic diagram illustrating the genomic regions or ORFs with most variation between different SARS-CoV and SARSr-CoV isolates.
Coding regions of the N-terminal domain (NTD) and receptor-binding domain (RBD) of the spike protein, ORF3a/b and ORF8 (8a/b) in bat SARSr-CoV genomes highly similar to those in SARS CoV genome are indicated with black boxes or arrows while the hollow boxes or arrows represent corresponding regions with less sequence similarity to those of SARS-CoV. The deletions in the RBD of some SARSr-CoVs are indicated by two vertical lines.


Co-circulation of different bat SARSr-CoVs with S, ORF8 and ORF3 sequences similar to those in SARS-CoV at a single location

The primary difference between SARS-CoV and most bat SARSr-CoVs is located in S gene. The S protein is functionally divided into two subunits, denoted S1 and S2, which is responsible for receptor binding and cellular membrane fusion, respectively. S1 consists of two domains, the N-terminal domain (NTD) and C-terminal domain (CTD) which is also known as the RBD in SARS-CoV [24]. SARS-CoV and bat SARSr-CoVs share high sequence identity in the S2 region in contrast to the S1 region. Among the 15 SARSr-CoVs identified from bats in the surveyed cave, six strains with deletions in their RBD regions (Rs4081, Rs4237, Rs4247, Rs4255, Rf4092 and As6526) showed 78.2% to 80.2% aa sequence identity to SARS-CoV in the S protein, while the other nine strains without deletions were much more closely related to SARS-CoV, with 90.0% (Rs4084) to 97.2% (Rs4874) aa sequence identity. These nine SARSr-CoVs can be further divided into four genotypes according to their S1 sequences (Fig 2): RsSHC014/Rs4084 showed more genetic differences from SARS-CoV in both NTD and RBD regions; The RBD sequences of SARSr-CoV Rs7327, Rs9401 and previously reported WIV1/Rs3367 closely resembled that of SARS-CoV. However, they were distinct from SARS-CoV but similar to RsSHC014 in NTD. In contrast, we found a novel SARSr-CoV, termed Rs4231, which shared highly similar NTD, but not RBD sequence with SARS-CoV (Figs ​(Figs22 and ​and3).3). Its S protein showed 94.6% to 95% aa sequence identity to those of human and civet SARS-CoVs (S1 Table). Strains with both NTD and RBD highly homologous to those of SARS-CoV were also present in this cave. In addition to WIV16 which we described previously [18], Rs4874 was also found to have the S protein closest to SARS-CoV S (> 97% aa sequence identity) of all the bat SARSr-CoVs reported to date (Figs ​(Figs22 and ​and3).3). In addition to the SARSr-CoVs subjected to full-length genome sequencing, we also obtained the RBD and NTD sequences from other samples collected in this cave. The sequences with high identity to SARS-CoV RBD were amplified from 10 more R. sinicus samples. SARSr-CoVs with this genotype of RBD were detected in different seasons throughout the five years. Strains containing the NTD similar to SARS-CoV were only found in 2013 (S2 Table).

Image
Fig 3. Amino acid sequence comparison of the S1 subunit (corresponding to aa 1–660 of the spike protein of SARS-CoV).
The receptor-binding domain (aa 318–510) of SARS-CoV and the homologous region of bat SARSr-CoVs are indicated by the red box. The key aa residues involved in the interaction with human ACE2 are numbered on top of the aligned sequences. SARS-CoV GZ02, BJ01 and Tor2 were isolated from patients in the early, middle and late phase, respectively, of the SARS outbreak in 2003. SARS-CoV SZ3 was identified from civets in 2003. SARSr-CoV Rs 672 and YN2013 were identified from R. sinicus collected in Guizhou and Yunnan Province, respectively. SARSr-CoV Rf1 and JL2012 were identified from R. ferrumequinum collected in Hubei and Jilin Province, respectively. WIV1, WIV16, RsSHC014, Rs4081, Rs4084, Rs4231, Rs4237, Rs4247, Rs7327 and Rs4874 were identified from R.sinicus, and Rf4092 from R. ferrumequinum in the cave surveyed in this study.


ORF8 is another highly variable gene among different SARS-CoV and SARSr-CoV strains [25,26]. We aligned the ORF8 nt sequences of the representative SARSr-CoVs discovered in this surveillance with those of other SARSr-CoVs and SARS-CoVs (Fig 4). Though WIV16, WIV1, Rs4231 and RsSHC014 were genetically closer to SARS-CoV in S gene, they contained a single 366-nt ORF8 without the 29-nt deletion present in most human SARS-CoVs and showed only 47.1% to 51.0% nt sequence identity to human and civet SARS-CoVs. However, the ORF8 of strain Rf4092 from R. ferrumequinum exhibited high similarity to that of civet SARS-CoV. It possessed a single long ORF8 of the same length (369 nt) as that of civet SARS-CoV strain SZ3, with only 10 nt mutations and 3 aa mutations detected (Fig 4). Similar ORF8 sequences were also amplified from other 7 samples collected in the cave during 2011 to 2013, from both R. ferrumequinum and R. sinicus (S2 Table). The ORF8 of Rs4084 was highly similar to Rf4092’s but was split into two overlapping ORFs, ORF8a and ORF8b, due to a short 5-nt deletion (Figs ​(Figs22 and ​and4).4). The position of start codons and stop codons of the two ORFs were consistent with those in most human SARS-CoV strains. Excluding the 8-aa insertion, Rs4084 and SARS-CoV strain BJ01 displayed identical aa sequence of ORF8a, and only three different aa residues were observed between their ORF8b (Fig 4). To our knowledge, Rs4084 was the first bat SARSr-CoV reported that resembled the late human SARS-CoVs in both ORF8 gene organization and sequence.

Image
Fig 4. Alignment of nucleotide sequences of ORF8 or ORF8a/8b.
The start codons and stop codons of ORF8, 8a and 8b are marked with black boxes and the forward and reverse arrows, respectively. The deletion responsible for the split ORF8a and 8b in human SARS-CoV BJ01, Tor2 and bat SARSr-CoV Rs4084 is marked with red boxes. See the legend for Fig 3 for the origin of various sequences used in this alignment.


Another key difference between SARS-CoV and bat SARSr-CoV genomes is the ORF3 coding region [10,17,21]. We analyzed the ORF3a sequences amplified from 42 samples and found that most of the SARSr-CoVs closely related to SARS-CoV in the S gene shared higher ORF3a sequence similarity (96.4% to 98.9% aa identity) with SARS-CoV (S3 Fig and S2 Table). The ORF3b of SARS CoV, sharing a large part of its coding sequence with the ORF3a, encodes a 154-aa protein [27], but it is truncated to different extents at the C-terminal in previously described bat SARSr-CoVs including WIV1 and WIV16 (S4 Fig). In the current study, we identified a non-truncated ORF3b for the first time (Rs7327), which maintained the nuclear localization signal at its C-terminal. Moreover, it shared 98.1% aa sequence identity with SARS-CoV strain Tor2 with only three aa substitutions (S4 Fig). Thus, Rs7327 is the bat SARSr-CoV most similar to SARS-CoV in the ORF3 region known to date.

Recombination analysis

The full-length genome sequences of all 15 SARSr-CoVs from the surveyed cave were screened for evidence of potential recombination events. Both similarity plot and bootscan analyses revealed frequent recombination events among these SARSr-CoV strains. It was suggested that WIV16, the closest progenitor of human SARS-CoV known to date [18], was likely to be a recombinant strain from three SARSr-CoVs harbored by bats in the same cave, namely WIV1, Rs4231 and Rs4081, with strong P value (<10−30). Breakpoints were identified at genome positions nt 18391, 22615 and 28160 (Fig 5A). In the genomic region between nt 22615 and 28160, which contained the region encoding the RBD and the S2 subunit of the S protein, WIV16 was highly similar to WIV1, sharing 99% sequence identity. In contrast, in the region between nt 18391 and 22615, which covered a part of ORF1b and the region encoding the NTD of the S gene, WIV16 showed substantially closer relationship to Rs4231. Meanwhile, the ORF1ab sequences upstream from nt 18391 of WIV16 displayed the highest genetic similarity (99.8% nt sequence identity) to that of Rs4081.

Image
Fig 5. Detection of potential recombination events by similarity plot and boot scan analysis.
(A) Full-length genome sequence of SARSr-CoV WIV16 was used as query sequence and WIV1, Rs4231 and Rs4081 as reference sequences. (B) Full-length genome sequence of SARS-CoV SZ3 was used as query sequence and SARSr-CoV WIV16, Rf4092 and Rs4081 as reference sequences. All analyses were performed with a Kimura model, a window size of 1500 base pairs, and a step size of 150 base pairs. The gene map of query genome sequences are used to position breakpoints.


Evidence of recombination event was also detected in the genome of the novel SARSr-CoV Rs4084, which had a unique genome organization with split ORF8a and 8b. The previously reported strain RsSHC014 and the newly identified strain Rf4092 were suggested to be the major and minor parent of Rs4084, respectively (P value < 10−80). The breakpoint was located at nt 26796 (S5 Fig). In the region downstream of the breakpoint including ORF8, Rs4084 showed closet genetic relationship with Rf4092, sharing 98.9% nt sequence identity, while it shared the highest nt sequence identity (99.4%) with RsSHC014 in the majority of its genome upstream from the breakpoint.

When civet SARS-CoV SZ3 was used as the query sequence in similarity plot and bootscan analysis, evidence for recombination events was also detected (Fig 5B). In the region between the two breakpoints at the genome positions nt 21161 and nt 27766, including the S gene, closer genetic relationship between SZ3 and WIV16 was observed. However, from position nt 27766 towards the 3’ end of its genome, a notably close genetic relationship was observed between SZ3 and Rf4092 instead. Throughout the non-structural gene, moreover, SZ3 shared a similarly high sequence identity with WIV16 and Rf4092. It indicates that civet SARS-CoV was likely to be the descendent from a recombinant of the precursors of WIV16 and Rf4092, or that the SARSr-CoVs found in this cave, like WIV16 or Rf4092, may have been the descendants of the SARS-CoV lineage.

Phylogenetic analysis

Phylogenetic trees were constructed using the nt sequences of nonstructural protein gene ORF1a and ORF1b. Unlike the high genetic diversity in the S gene, nearly all SARSr-CoVs from the bat cave we surveyed were closely clustered, and showed closer phylogenetic relationship to SARS-CoV than the majority of currently known bat SARSr-CoVs discovered from other locations, except YNLF_31C and 34C which were recently reported in greater horseshoe bats from another location in Yunnan [22] (Fig 6). The phylogeny of SARSr-CoVs in ORF1a and ORF1b appeared to be associated with their geographical distribution rather than with host species. Regardless of different host bat species, SARS-CoV and SARSr-CoVs detected in bats from southwestern China (Yunnan, Guizhou and Guangxi province) formed one clade, in which SARSr-CoV strains showing closer relationship to SARS-CoV were all from Yunnan. SARSr-CoVs detected in southeastern, central and northern provinces, such as Hong Kong, Hubei and Shaanxi, formed the other clade which was phylogenetically distant to human and civet SARS-CoVs (Fig 6 and S6 Fig).

Image
Fig 6. Phylogenetic trees based on nucleotide sequences of ORF1a (A) and ORF1b (B). The trees were constructed by the maximum likelihood method using the LG model with bootstrap values determined by 1000 replicates. Only bootstraps > 50% are shown. The scale bars represent 0.03 (A) and 0.02 (B) substitutions per nucleotide position. Rs, Rhinolophus sinicus; Rf, Rhinolophus ferremequinum; Rm, Rhinolophus macrotis; Ra, Rhinolophus affinis; Rp, Rhinolophus pusillus; As, Aselliscus stoliczkanus; Cp, Chaerephon plicata. SARSr-CoVs detected in bats from the single cave surveyed in this study are in bold. Sequences detected in southwestern China are indicated in red.

Rescue of bat SARSr-CoVs and virus infectivity experiments

In the current study, we successfully cultured an additional novel SARSr-CoV Rs4874 from a single fecal sample using an optimized protocol and Vero E6 cells [17]. Its S protein shared 99.9% aa sequence identity with that of previously isolated WIV16 and it was identical to WIV16 in RBD. Using the reverse genetics technique we previously developed for WIV1 [23], we constructed a group of infectious bacterial artificial chromosome (BAC) clones with the backbone of WIV1 and variants of S genes from 8 different bat SARSr-CoVs. Only the infectious clones for Rs4231 and Rs7327 led to cytopathic effects in Vero E6 cells after transfection (S7 Fig). The other six strains with deletions in the RBD region, Rf4075, Rs4081, Rs4085, Rs4235, As6526 and Rp3 (S1 Fig) failed to be rescued, as no cytopathic effects was observed and viral replication cannot be detected by immunofluorescence assay in Vero E6 cells (S7 Fig). In contrast, when Vero E6 cells were respectively infected with the two successfully rescued chimeric SARSr-CoVs, WIV1-Rs4231S and WIV1-Rs7327S, and the newly isolated Rs4874, efficient virus replication was detected in all infections (Fig 7). To assess whether the three novel SARSr-CoVs can use human ACE2 as a cellular entry receptor, we conducted virus infectivity studies using HeLa cells with or without the expression of human ACE2. All viruses replicated efficiently in the human ACE2-expressing cells. The results were further confirmed by quantification of viral RNA using real-time RT-PCR (Fig 8).

Image
Fig 7. Infection of Vero E6 cells by bat SARSr-CoV WIV1, Rs4874, WIV1-Rs4231S and WIV1-Rs7327S.
(A) The successful infection was confirmed by immunofluorescent antibody staining using rabbit antibody against the SARSr-CoV Rp3 nucleocapsid protein. The columns (from left to right) show staining of nuclei (blue), virus replication (red), and both nuclei and virus replication (merged double-stain images). (B) The growth curves in Vero E6 cells with a MOI of 1.0 and 0.01.


Image
Fig 8. Analysis of receptor usage by immunofluorescence assay (A) and real-time PCR (B). Virus infectivity of Rs4874, WIV1-Rs4231S and WIV1-Rs7327S was determined in HeLa cells with and without the expression of human ACE2. ACE2 expression was detected with goat anti-human ACE2 antibody followed by fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat IgG. Virus replication was detected with rabbit antibody against the SARSr-CoV Rp3 nucleocapsid protein followed by cyanine 3 (Cy3)-conjugated mouse anti-rabbit IgG. Nuclei were stained with DAPI (49,6-diamidino-2-phenylindole).The columns (from left to right) show staining of nuclei (blue), ACE2 expression (green), virus replication (red) and the merged triple-stained images, respectively.

Activation of activating transcription factor 6 (ATF6) by the ORF8 proteins of different bat SARSr-CoVs

The induction of the ATF6-dependent transcription by the ORF8s of SARS-CoV and bat SARSr-CoVs were investigated using a luciferase reporter, 5×ATF6-GL3. In HeLa cells transiently transfected with the expression plasmids of the ORF8s of bat SARSr-CoV Rf1, Rf4092 and WIV1, the relative luciferase activities of the 5×ATF6-GL3 reporter was enhanced by 5.56 to 9.26 folds compared with cells transfected with the pCAGGS empty vector, while it was increased by 4.42 fold by the SARS-CoV GZ02 ORF8. As a control, the treatment with tunicamyxin (TM) stimulated the transcription by about 11 folds (Fig 9A). The results suggests that various ORF8 proteins of bat SARSr-CoVs can activate ATF6, and those of some strains have a stronger effect than the SARS-CoV ORF8.

Image
Fig 9. Functional characterization of diverse ORF8 and ORF8a proteins of bat SARSr-CoVs.
(A) The ORF8 proteins of SARS-CoV and bat SARSr-CoVs induces the ATF6-dependent transcriptional activity. HeLa cells were transiently transfected with the pcAGGS expression plasmids of the ORF8 of SARS-CoV GZ02, bat SARSr-CoV Rf1, WIV1 and Rf4092 and the reporter plasmid 5×ATF6-GL3 for 40h. Control cells were co-transfected with the reporter plasmid and the empty pCAGGS vector for 24h, and treated with or without TM (2μg/ml) for an additional 16h. The cell lysates were harvested for dual luciferase assay and data are shown as the average values from triplicate wells. (B) The ORF8a proteins of SARS-CoV and bat SARSr-CoV triggered apoptosis. 293T cells were transfected with the expression plasmids of the ORF8a of SARS-CoV Tor2 and bat SARSr-CoV Rs4084 and a pcAGGS vector control for 24h. Apoptosis was analyzed by flow cytometry after annexin V staining and the percentage of apoptotic cells were calculated. Data are shown as the average values from triplicate cells. Error bars indicate SDs. * P<0.05.


Induction of apoptosis by the ORF8a of the newly identified bat SARSr-CoV

We conducted transient transfection to examine whether the ORF8a of SARSr-CoV Rs4084 triggered apoptosis. As shown in Fig 9B, 11.76% and 9.40% of the 293T cells transfected with the SARSr-CoV Rs4084-ORF8a and SARS-CoV Tor2-ORF8a expression plasmid underwent apoptosis, respectively. In contrast, transfection with the empty vector resulted in apoptosis in only 2.79% of the cells. The results indicate that Rs4084 ORF8a has an apoptosis induction activity similar to that of SARS-CoV [28].

Discussion

Genetically diverse SARSr-CoVs have been detected in various horseshoe bat species across a wide geographic range in China in the past decade [9–12,14,29]. However, most bat SARSr-CoVs show considerable genetic distance to SARS-CoV, particularly in the highly variable S1, ORF8 and ORF3 regions [10,25]. Recently, several novel SARSr-CoVs have been described to be more closely related to SARS-CoV, either in the S gene or in ORF8. The S proteins of RsSHC014, Rs3367, WIV1 and WIV16, which were reported in our previous studies, shared 90% to 97% aa sequence identities to those of human/civet SARS-CoVs [17,18]. Another strain from Rhinolophus affinis in Yunnan termed LYRa11 showed 90% aa sequence identity to SARS-CoV in the S gene [13]. In addition, two studies have described 4 novel SARSr-CoVs (YNLF_31C/34C and GX2013/YN2013) which possessed a full-length ORF8 with substantially higher similarity to that of SARS-CoV [22,30]. These findings provide strong genetic evidence for the bat origin of SARS-CoV with regard to the S gene or ORF8. However, all of these SARSr-CoVs were distinct from SARS-CoV in at least one other gene, suggesting that none of them was the immediate progenitor of SARS-CoV. Moreover, these SARSr-CoVs were discovered in bat populations from physically distinct locations. The site of origin of the true progenitor of SARS-CoV and the evolutionary origin of SARS-CoV have until now remained elusive. In the current study, we have identified a bat habitat potentially important for SARSr-CoV evolution where a series of recombination events have likely occurred among different SARSr-CoV strains, which provides new insights into the origin of SARS-CoV.

SARS first emerged in Guangdong province in late 2002 [7]. However, SARSr-CoVs discovered in bats from neighboring areas of Guangdong to date have shown phylogenetic disparity from SARS-CoV especially in the S gene [9,10,14], suggesting SARS-CoV may have originated from another region. Our analysis of the phylogeny of SARS-CoVs and all known bat SARSr-CoVs using the nt sequence of their non-structural ORF1a and ORF1b genes, which constitute the majority of the genome, shows that SARSr-CoV evolution is strongly correlated with their geographical origin, but not host species. It is noteworthy that SARSr-CoVs detected in Yunnan are more closely related to SARS-CoV than strains from other regions in China. This finding implies that Yunnan, or southwestern China, is more likely to be the geographical source of SARS-CoV than other regions in China, but data from more extensive surveillance are yet needed to support this inference.

In our longitudinal surveillance of SARSr-CoVs in a single cave in Yunnan where we discovered Rs3367, RsSHC014, WIV1 and WIV16,
the CoV prevalence in fecal samples varied among different sampling time. Generally, a higher prevalence was observed in autumn (September and October) than in spring and early summer (April and May). This may be due to the establishment of a susceptible subpopulation of newborn bats which had not developed their own immunity after the parturition period [31]. Another factor may be the changes in the composition of bat species in the cave at different sampling dates. For example, in September 2012 when the CoV prevalence reached 51.3%, the majority of samples were from R. sinicus, but in May 2015 when only 3 out of the 145 samples tested positive, Aselliscus stoliczkanus was the predominant bat species in the cave. We failed to amplify the RBD sequences from 15 of the 64 SARSr-CoV positive samples. Most of these samples had comparatively low viral concentration (< 107 copies/g) (S8 Fig), as revealed by our previous quantitative studies [32]. The unsuccessful amplification of RBD in some samples with high viral concentration was probably because of the more divergent sequences in this region of these SARSr-CoV genomes.

In this cave, we have now obtained full-length genome sequences of additional 11 novel SARSr-CoVs from bats. Our findings suggest the co-circulation of different bat SARSr-CoVs highly similar to SARS-CoV in the most variable S1 (NTD and RBD), ORF8 and ORF3 regions, respectively, in this single location. In the ORF1a, ORF1b, E, M and N genes, the SARSr-CoVs circulating in this cave also shared > 98% aa sequence identities with human/civet SARS-CoVs. Thus, all of the building blocks of the SARS-CoV genome were present in SARSr-CoVs from this single location in Yunnan during our sampling period. Furthermore, strains closely related to different representative bat SARSr-CoVs from other provinces (e.g. Rs672, HKU3 and Rf1) in the RBD region were also detected there. Therefore, this cave could be regarded as a rich gene pool of bat SARSr-CoVs, wherein concurrent circulation of a high diversity of SARSr-CoV strains has led to an unusually diverse assemblage of SARSr-CoVs.

During our 5-year surveillance in this single cave, we first reported Rs3367 and WIV1 in 2013, with RBD sequence closely resembling that of SARS-CoV [17]. More recently, we discovered WIV16 which had an RBD almost identical to WIV1’s but shared much higher similarity with SARS-CoV than WIV1 in the NTD region of S1, making it the closest SARSr-CoV to the epidemic strains identified to date [18]. In this study, we found a novel strain Rs4231 from the same location sharing almost identical NTD sequence with WIV16 but distinct from it in the RBD, with evidence of a recombination event. Our recombination analysis indicated that a recombination event may have taken place at the junction between the coding region of NTD and RBD in the Rs4231 and WIV1 genomes and resulted in WIV16. Recombination at this genomic position also happened among other SARSr-CoVs relatively distant to SARS-CoV found in this location (e.g. Rs4081 and Rs4247, S5 Fig). The frequent recombination at this hotspot in the S gene increased the genetic diversity of SARSr-CoVs harbored in these bat populations and might have been responsible for the generation of the S gene of the direct progenitor strain of SARS-CoV.

The genomes of SARS-CoVs from patients during the early epidemic phase and civet SARS-CoVs all contained a single full-length ORF8 [3,7]. We have found that a number of bat SARSr-CoVs from this cave possessed a complete ORF8 highly similar to that of early human/civet SARS-CoV (>97% nt sequence identity), represented by strain Rf4092 (S3C Fig). This provided further evidence for the source of human SARS-CoV ORF8 in bats [22,30]. In contrast, the ORF8 was split into overlapping ORF8a and ORF8b in most human SARS-CoV strains from later-phase patients due to the acquisition of a 29-nt deletion [8,26]. In this study, we have discovered for the first time a bat SARSr-CoV with ORF8a and ORF8b highly similar to the later-phase human SARS-CoVs, though the split of ORF8 in the bat SARSr-CoV and that in human SARS-CoV were two independent events. Our recombination analysis suggests that this strain, Rs4084, likely acquired its ORF8 from Rf4092 through recombination, followed by the development of the 5-nt deletion which led to the splitting. It suggests that ORF8 region in bat SARSr-CoV genomes is prone to deletions as in human SARS-CoV [3,25]. Finally, the recombination analysis suggests that an ancestral strain of SARS-CoV SZ3 would have been generated if the recombination around ORF8 had occurred between the lineages that led to WIV16 and Rf4092. Taken together, the evidence of recombination events among SARSr-CoVs harbored by bats in this single location suggests that the direct progenitor of SARS-CoV may have originated as a result of a series of recombination within the S gene and around ORF8. This could have been followed by the spillover from bats to civets and people either in the region, or during movement of infected animals through the wildlife trade. However, given the paucity of data on animal trade prior to the SARS outbreak, the likely high geographical sampling bias in bat surveillance for SARSr-CoVs in southern China, and the possibility that other caves harbor similar bat species assemblages and a rich diversity of SARSr-CoVs, a definite conclusion about the geographical origin of SARS-CoV cannot be drawn at this point.


R. sinicus are regarded as the primary natural host of SARS-CoV, as all SARSr-CoVs highly homologous to SARS-CoV in the S gene were predominantly found in this species. However, it is noted that two SARSr-CoVs previously reported from R. ferrumequinum showed the closest phylogenetic position to SARS-CoV in the ORF1a/1b trees. These strains were discovered in another location in Yunnan 80 km from the cave surveyed in the current study [22]. This information also supports the speculation that SARS-CoV may have originated from this region. Nonetheless, since the correlation between the host species and the phylogeny of SARSr-CoV ORF1ab seems limited, more SARSr-CoV sequences need to be obtained from different Rhinolophus bat species in both locations in Yunnan, and from other locations in southern China. In particular, it will be important to assess whether R. ferrumequinum played a more important role in the evolution of SARS-CoV ORF1ab.

The cave we studied is located approximately 60 km from the city of Kunming. Beside a number of rhinolophid and hipposiderid species from which SARSr-CoVs have been detected, other bats like myotis were also present there. The temperature in the cave is around 22–25°C and the humidity around 85%-90%. The physical nature of the cave is not unique, but it does appear to host a particularly dense population of bats in the reproductive season. Similar caves co-inhabited by bat populations of different species are not rare in other areas in Yunnan. We propose that efforts to study the ecology, host species diversity, and viral strain populations of these caves may provide critical information on what drives SARSr-CoV evolution.

Our previous studies demonstrated the capacity of both WIV1 and WIV16 to use ACE2 orthologs for cell entry and to efficiently replicate in human cells [17,18]. In this study, we confirmed the use of human ACE2 as receptor of two novel SARSr-CoVs by using chimeric viruses with the WIV1 backbone replaced with the S gene of the newly identified SARSr-CoVs. Rs7327’s S protein varied from that of WIV1 and WIV16 at three aa residues in the receptor-binding motif, including one contact residue (aa 484) with human ACE2. This difference did not seem to affect its entry and replication efficiency in human ACE2-expressing cells. A previous study using the SARS-CoV infectious clone showed that the RsSHC014 S protein could efficiently utilize human ACE2 [33], despite being distinct from SARS-CoV and WIV1 in the RBD (S1 Fig). We examined the infectivity of Rs4231, which shared similar RBD sequence with RsSHC014 but had a distinct NTD sequence, and found the chimeric virus WIV1-Rs4231S also readily replicated in HeLa cells expressing human ACE2 molecule. The novel live SARSr-CoV we isolated in the current study (Rs4874) has an S gene almost identical to that of WIV16. As expected, it is also capable of utilizing human ACE2. These results indicate that diverse variants of SARSr-CoV S protein without deletions in their RBD are able to use human ACE2. In contrast, our previous study revealed that the S protein of a R. sinicus SARSr-CoV with deletions (Rp3) failed to use human, civet and bat ACE2 for cell entry [34]. In this study, in addition to Rs4231 and Rs7327, we also constructed infectious clones with the S gene of Rs4081, Rf4075, Rs4085, Rs4235 and As6526, which all contained the deletions in their RBD. These 7 strains, plus Rs4874 and the previously studied WIV1 and RsSHC014, could represent all types of S variants of SARSr-CoVs in this location (S3A Fig). However, none of the strains with deletions in the RBD could be rescued from Vero E6 cells. Therefore, the two distinct clades of SARSr-CoV S gene may represent the usage of different receptors in their bat hosts.

The full-length ORF8 protein of SARS-CoV is a luminal endoplasmic reticulum (ER) membrane-associated protein that induces the activation of ATF6, an ER stress-regulated transcription factor that activates the transcription of ER chaperones involved in protein folding [35]. We amplified the ORF8 genes of Rf1, Rf4092 and WIV1, which represent three different genotypes of bat SARSr-CoV ORF8 (S3C Fig), and constructed the expression plasmids. All of the three ORF8 proteins transiently expressed in HeLa cells can stimulate the ATF6-dependent transcription. Among them, the WIV1 ORF8, which is highly divergent from the SARS-CoV ORF8, exhibited the strongest activation. The results indicate that the variants of bat SARSr-CoV ORF8 proteins may play a role in modulating ER stress by activating the ATF6 pathway. In addition, the ORF8a protein of SARS-CoV from the later phase has been demonstrated to induce apoptosis [28]. In this study, we have found that the ORF8a protein of the newly identified SARSr-CoV Rs4084, which contained an 8-aa insertion compared with the SARS-CoV ORF8a, significantly triggered apoptosis in 293T cells as well.

Compared with the 154-aa ORF3b of SARS-CoV, the ORF3b proteins of all previously identified bat SARSr-CoVs were smaller in size due to the early translation termination. However, for the first time, we discovered an ORF3b without the C-terminal truncation in a bat SARSr-CoV, Rs7327, which differed from the ORF 3b of SARS-CoV GZ02 strain at only one aa residue. The SARS-CoV ORF3b antagonizes interferon function by modulating the activity of IFN regulatory factor 3 (IRF3) [27]. As previous studies suggested, the nuclear localization signal-containing C-terminal may not be required for the IFN antagonist activity of ORF3b [36]. Our previous studies also demonstrated that the ORF3b protein of a bat SARSr-CoV, termed Rm1, which was C-terminally truncated to 56 aa and shared 62% aa sequence identity with SARS-CoV, still displayed the IFN antagonist activity [37]. It is very interesting to investigate in further studies whether Rs7327’s ORF3b and other versions of truncated ORF3b such as WIV1 and WIV16 also show IFN antagonism profiles.

As a whole, our findings from a 5-year longitudinal study conclusively demonstrate that all building blocks of the pandemic SARS-CoV genome are present in bat SARSr-CoVs from a single location in Yunnan. The data show that frequent recombination events have happened among those SARSr-CoVs in the same cave. While we cannot rule out the possibility that similar gene pools of SARSr-CoVs exist elsewhere, we have provided sufficient evidence to conclude that SARS-CoV most likely originated from horseshoe bats via recombination events among existing SARSr-CoVs. In addition, we have also revealed that various SARSr-CoVs capable of using human ACE2 are still circulating among bats in this region. Thus, the risk of spillover into people and emergence of a disease similar to SARS is possible. This is particularly important given that the nearest village to the bat cave we surveyed is only 1.1 km away, which indicates a potential risk of exposure to bats for the local residents. Thus, we propose that monitoring of SARSr-CoV evolution at this and other sites should continue, as well as examination of human behavioral risk for infection and serological surveys of people, to determine if spillover is already occurring at these sites and to design intervention strategies to avoid future disease emergence.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 7:16 am

Part 2 of 2

Materials and methods

Ethics statement


All sampling procedures were performed by veterinarians with approval from Animal Ethics Committee of the Wuhan Institute of Virology (WIVH05210201). The study was conducted in accordance with the Guide for the Care and Use of Wild Mammals in Research of the People’s Republic of China.

Sampling

Bat samplings were conducted ten times from April 2011 to October 2015 at different seasons in their natural habitat at a single location (cave) in Kunming, Yunnan Province, China. All members of field teams wore appropriate personal protective equipment, including N95 masks, tear-resistant gloves, disposable outerwear, and safety glasses. Bats were trapped and fecal swab samples were collected as described previously [9]. Clean plastic sheets measuring 2.0 by 2.0 m were placed under known bat roosting sites at about 18:00 h each evening for collection of fecal samples. Fresh fecal pellets were collected from sheets early in the next morning. Each sample (approximately 1 gram of fecal pellet) was collected in 1ml of viral transport medium composed of Hank's balanced salt solution at pH7.4 containing BSA (1%), amphotericin (15 μg/ml), penicillin G (100 units/ml), and streptomycin (50 μg/ml), and were stored at -80°C until processing. Bats trapped for this study were released back into their habitat.

RNA extraction, PCR screening and sequencing

Fecal swab or pellet samples were vortexed for 1 min, and 140 μl of supernatant was collected from each sample after centrifuge at 3000 rpm under 4°C for 1min. Viral RNA was extracted with Viral RNA Mini Kit (Qiagen) following the manufacturer’s instructions. RNA was eluted in 60 μl of buffer AVE (RNase-free water with 0.04% sodium azide, Qiagen), aliquoted, and stored at -80°C. One-step hemi-nested RT-PCR (Invitrogen) was employed to detect the presence of coronavirus sequences as described previously using a set of primers that target a 440-nt fragment in the RNA-dependent RNA polymerase gene (RdRp) of all known alpha- and betacoronaviruses [20]. For the first round PCR, the 25 μl reaction mix contained 12.5 μl PCR 2 × reaction mix buffer, 10 pmol of each primer, 2.5 mM MgSO4, 20 U RNase inhibitor, 1 μl SuperScript III/Platinum Taq Enzyme Mix and 5 μl RNA template. The amplification was performed as follows: 50°C for 30 min, 94°C for 2 min, followed by 40 cycles consisting of 94°C for 15 sec, 52°C for 30 sec, 68°C for 40 sec, and a final extension of 68°C for 5 min. For the second round PCR, the 25 μl reaction mix contained 2.5 μl PCR reaction buffer, 5 pmol of each primer, 50 mM MgCl2, 0.5mM dNTP, 0.1 μl Platinum Taq Enzyme (Invitrogen) and 1 μl product of the first round PCR. The amplification was performed as follows: 94°C for 3 min followed by 35 cycles consisting of 94°C for 30 sec, 52°C for 30 sec, 72°C for 40 sec, and a final extension of 72°C for 7 min. The RBD region was amplified using the one-step nested RT-PCR method previously described [17].

PCR products were gel purified and sequenced with an ABI Prism 3730 DNA analyzer (Applied Biosystems, USA). PCR products with low concentration or generating heterogeneity in the sequencing chromatograms were cloned into pGEM-T Easy Vector (Promega) for sequencing. The positive samples in this study were termed using the abbreviated name of bat species plus the sample ID number (e.g. Rs4081). To confirm the bat species of individual sample, PCR amplification of cytochrome b (Cytob) or NADH dehydrogenase subunit 1 (ND1) gene was performed using DNA extracted from the feces or swabs [38,39].

Sequencing of full-length genomes

Full genomic sequences of 11 SARSr-CoVs were determined by One-step PCR (Invitrogen) amplification of overlapping genomic fragments with degenerate primers designed by multiple alignment of available SARS-CoV and bat SARSr- CoV sequences deposited in GenBank, and additional specific primers designed from the results of previous rounds of sequencing in this study. Primer sequences are available upon request. Sequences of the 5’ and 3’ genomic ends were obtained by 5’ and 3’ RACE (Roche), respectively. PCR products with expected size were gel-purified and subjected directly to sequencing. Each fragment was sequenced at least twice. The sequencing chromatogram of each product was thoroughly examined and sequence heterogeneity was not observed. For some fragments with low concentration of amplicons, the PCR products were cloned into pGEM-T Easy Vector (Promega) for sequencing. At least five independent clones were sequenced to obtain a consensus sequence. Co-presence of sequences of distinct SARSr-CoVs was not found in any of the amplicons. The sequences of overlapping genomic fragments were assembled to obtain the full-length genome sequences, with each overlapping sequence longer than 100 bp.

Evolution analysis

Full-length genome sequences of the 15 SARSr-CoVs detected from bats in the cave surveyed in this study were aligned with those of selected SARS-CoVs using MUSCLE [40]. The aligned sequences were scanned for recombination events by Recombination Detection Program (RDP) [41]. The potential recombination events suggested by strong P values (<10−20) were further confirmed using similarity plot and bootscan analyses implemented in Simplot 3.5.1 [42]. Phylogenetic trees based on nucleotide sequences were constructed using the Maximum Likelihood algorithm under the LG model with bootstrap values determined by 1000 replicates in the PhyML (version 3.0) software package [43].

Virus isolation

The Vero E6 cell line was kindly provided by Australian Animal Health Laboratory, CSIRO (Geelong, Australia). Vero E6 monolayer was maintained in DMEM medium supplemented with 10% fetal calf serum (FCS). Fecal samples (in 200 μl buffer) were gradient centrifuged at 3,000–12,000 g, and the supernatant was diluted 1:10 in DMEM before being added to Vero E6 cells. After incubation at 37°C for 1 h, the inoculum was removed and replaced with fresh DMEM medium with 2% FCS. The cells were incubated at 37°C and checked daily for cytopathic effect. All tissue culture media were supplemented with triple antibiotics penicillin/ streptomycin/amphotericin (Gibco) (penicillin 200 IU/ml, streptomycin 0.2 mg/ml, amphotericin 0.5 μg/ml). Three blind passages were carried out for each sample. After each passage, both the culture supernatant and cell pellet were examined for presence of SARSr-CoV by RT-PCR using specific primers targeting the RdRp or S gene. The viruses which caused obvious cytopathic effect and could be detected in three blind passages by RT-PCR were further confirmed by electron microscopy.

Construction of recombinant viruses

Recombinant viruses with the S gene of the novel bat SARSr-CoVs and the backbone of the infectious clone of SARSr-CoV WIV1 were constructed using the reverse genetic system described previously [23] (S9 Fig). The fragments E and F were re-amplified with primer pairs (FE, 5’-AGGGCCCACCTGGCACTGGTAAGAGTCATTTTGC-3’, R-EsBsaI, 5’-ACTGGTCTCTTCGTTTAGTTATTAACTAAAATATCACTAGACACC-3’) and (F-FsBsaI, 5’-TGAGGTCTCCGAACTTATGGATTTGTTTATGAG-3’, RF, 5’-AGGTAGGCCTCTAGGGCAGCTAAC-3’), respectively. The products were named as fragment Es and Fs, which leave the spike gene coding region as an independent fragment. BsaI sites (5’-GGTCTCN|NNNN-3’) were introduced into the 3’ terminal of the Es fragment and the 5’ terminal of the Fs fragment, respectively. The spike sequence of Rs4231 was amplified with the primer pair (F-Rs4231-BsmBI, 5’-AGTCGTCTCAACGAACATGTTTATTTTCTTATTCTTTCTCACTCTCAC-3’ and R-Rs4231-BsmBI, 5’-TCACGTCTCAGTTCGTTTATGTGTAATGTAATTTGACACCCTTG-3’). The S gene sequence of Rs7327 was amplified with primer pair (F-Rs7327-BsaI, 5’-AGTGGTCTCAACGAACATGAAATTGTTAGTTTTAGTTTTTGCTAC-3’ and R-Rs7327-BsaI, 5’- TCAGGTCTCAGTTCGTTTATGTGTAATGTAATTTAACACCCTTG-3’). The fragment Es and Fs were both digested with BglI (NEB) and BsaI (NEB). The Rs4231 S gene was digested with BsmBI. The Rs7327 S gene was digested with BsaI. The other fragments and bacterial artificial chromosome (BAC) were prepared as described previously. Then the two prepared spike DNA fragments were separately inserted into BAC with Es, Fs and other fragments. The correct infectious BAC clones were screened. The chimeric viruses were rescued as described previously [23].

Determination of virus infectivity by immunofluorescence assay

The HeLa cell line was kindly provided by Australian Animal Health Laboratory, CSIRO (Geelong, Australia). HeLa cells expressing human ACE2 were constructed as described previously [17]. HeLa cells expressing human ACE2 and Vero E6 cells were cultured on coverslips in 24-well plates (Corning) incubated with the newly isolated or recombinant bat SARSr-CoVs at a multiplicity of infection (MOI) = 1.0 for 1h. The inoculum was removed and the cells were washed twice with PBS and supplemented with medium. Vero E6 cells without virus inoculation and HeLa cells without ACE2 were used as negative control. Twenty-four hours after infection, cells were rinsed with PBS and fixed with 4% formaldehyde in PBS (pH7.4) at 4°C for 20 min. ACE2 expression was detected by using goat anti-human ACE2 immunoglobulin followed by FITC-labelled donkey anti-goat immunoglobulin (PTGLab). Virus replication was detected by using rabbit antibody against the nucleocapsid protein of bat SARSr-CoV Rp3 followed by Cy3-conjugated mouse anti-rabbit IgG. Nuclei were stained with DAPI. Staining patterns were observed under an FV1200 confocal microscope (Olympus).

Determination of virus replication in Vero E6 cells by plaque assay

Vero E6 cells were infected with WIV1, Rs4874, WIV1-Rs4231S, and WIV1-Rs7327S at an MOI of 1.0 and 0.01. After incubation for an hour, the cells were washed with DHanks for three times and supplied with DMEM containing 2% FCS. Samples were collected at 0, 10, 27, and 48 h post infection. The viral titers were determined by plaque assay.

Determination of virus replication in HeLa cells expressing human ACE2 by quantitative RT-PCR

HeLa cells expressing human ACE2 were inoculated with WIV1, Rs4874, WIV1-Rs4231S, and WIV1-Rs7327S at an MOI of 1.0, and were incubated for 1h at 37°C. After the inoculum was removed, the cells were supplemented with medium containing 1% FBS. Supernatants were collected at 0, 12, 24 and 48h. Virus titers were determined using quantitative RT-PCR targeting the partial N gene with a standard curve which expresses the correlation between Ct value and virus titer (shown as TCID50/ml). The standard curve was made using RNA dilutions from the purified Rs4874 virus stock (with a titer of 2.15 × 106 TCID50/ml). For qPCR, RNA was extracted from 140 μl of each supernatant with Viral RNA Mini Kit (Qiagen) following manufacturer’s instructions and eluted in 60 μl AVE buffer. The PCR was performed with the TaqMan AgPath-ID One-Step RT–PCR Kit (Applied Biosystems) in a 25 μl reaction mix containing 4 μl RNA, 1 × RT–PCR enzyme mix, 1 × RT–PCR buffer, 40 pmol forward primer (5’-GTGGTGGTGACGGCA AAATG-3’), 40 pmol reverse primer (5’-AAGTGAAGCTTCTGGGCCAG-3’) and 12 pmol probe (5’-FAM-AAAGAGCTCAGCCCCAGATG-BHQ1-3’). The amplification was performed as follows: 50°C for 10 min, 95°C for 10 min followed by 50 cycles consisting of 95°C for 15 sec and 60°C for 20 sec.

Plasmids

The ORF8 genes of bat SARSr-CoV WIV1 and Rf4092 and the ORF8a gene of bat SARSr-CoV Rs4084 were amplified by PCR from the viral RNA extracted from the isolated virus or fecal samples. The ORF8 gene of SARS-CoV GZ02 and bat SARSr-CoV Rf1, and the ORF8a gene of SARS-CoV Tor2 were synthesized by Tsingke Biological Technology Co., Ltd (Wuhan, China). All genes were cloned into the pCAGGS vector constructed with a C-terminal HA tag. Expression of the proteins was confirmed by Western blotting using a mAb against the HA tag. Five tandem copies of the ATF6 consensus binding sites were synthesized and inserted into the pGL3-Basic vector to construct the luciferase reporter plasmid 5×ATF6-GL3, in which the luciferase gene is under the control of the c-fos minimal promoter and the ATF6 consensus binding sites.

Luciferase reporter assay

HeLa cells in 24-well plates were transfected using Lipofectamine 3000 reagent (Life Technologies) following the manufacturer’s instruction. Cells per well were co-transfected with 600ng of the 5×ATF6-GL3 reporter plasmid, with 300ng of each expression plasmid of SARS-CoV and SARSr-CoV ORF8 or empty vector and 20ng of pRL-TK (Promega) which served as an internal control. The cells were incubated for 24h, and were treated with or without 2μg/ml tunicamycin for 16h. Cells were harvested and lysed. Luciferase activity was determined using a dual-luciferase assay system (Promega). The experiment was performed in triplicate wells.

Quantification of apoptotic cells

293T cells in 12-well plates were transfected using Lipofectamine 3000 reagent (Life Technologies) following the manufacturer’s instruction. Cells per well were transfected with 3μg of the expression plasmid of SARS-CoV Tor2 or SARSr-CoV Rs4084 ORF8a, or the empty vector. 24h post transfection, apoptotic cells were quantified by using the Annexin V-fluorescein isothiocyanate (FITC)/PI Apoptosis Detection Kit (Yeasen Biotech, Shanghai) in accordance with the manufacturer’s instruction. Apoptosis was analyzed by flow cytometry. The experiment was performed in triplicate wells.

Accession numbers

The complete genome sequences of bat SARS-related coronavirus strains As6526, Rs4081, Rs4084, Rf4092, Rs4231, Rs4237, Rs4247, Rs4255, Rs4874, Rs7327 and Rs9401 have been deposited in the GenBank database with the accession numbers from KY417142 to KY417152, respectively.

Supporting information

S1 Fig
Alignment of amino acid sequences of the receptor-binding motif (corresponding to aa 424–495 of SARS-CoV S protein).
Two clades of the SARSr-CoVs identified from bats in the studied cave are indicated with vertical lines on the left.

(PPTX)

Click here for additional data file.(94K, pptx)

S2 Fig
Alignment of nucleotide sequences of a genomic region covering ORF6 to ORF7a.
ORFX is located between ORF6 and ORF7a in the genomes of WIV1, WIV16, Rs7327 and Rs4874. The start codon and stop codon of ORFX are marked with red boxes. The deletion responsible for the long ORFX in Rs7327 and Rs4874 is marked with the blue box.

(PPTX)

Click here for additional data file.(165K, pptx)

S3 Fig
Phylogenetic analyses based on nucleotide sequences of the S gene (A), ORF3a (B) and ORF8 (C). The trees were constructed by the maximum likelihood method using the LG model with bootstrap values determined by 1000 replicates. Only bootstraps > 50% are shown. Rs, Rhinolophus sinicus; Rf, Rhinolophus ferremequinum; Rm, Rhinolophus macrotis; Ra, Rhinolophus affinis; Rp, Rhinolophus pusillus; As, Aselliscus stoliczkanus; Cp, Chaerephon plicata. SARSr-CoVs detected in bats from the single cave surveyed in this study are in bold.

(PPTX)

Click here for additional data file.(1.7M, pptx)

S4 Fig
Alignment of amino acid sequences of ORF3b protein.
(PPTX)

Click here for additional data file.(144K, pptx)

S5 Fig
Detection of potential recombination events by similarity plot and boot scan analysis.
(A) Full-length genome sequence of SARSr-CoV Rs4084 was used as query sequence and RsSHC014, Rf4092 and Rs4081 as reference sequences. (B) Full-length genome sequence of SARSr-CoV Rs4237 was used as query sequence and SARSr-CoV Rs4247, Rs4081 and Rs3367 as reference sequences. All analyses were performed with a Kimura model, a window size of 1500 base pairs, and a step size of 150 base pairs.

(PPTX)

Click here for additional data file.(850K, pptx)

S6 Fig
Chinese provinces where bat SARSr-CoVs have been detected.
(PPTX)

Click here for additional data file.(83K, pptx)

S7 Fig
The successful or failed rescue of the chimeric SARSr-CoVs.
(A) Cytopathic effects in Vero E6 cells transfected with the infectious BAC clones constructed with the backbone of WIV1 and various S genes of different bat SARSr-CoV strains. Microphotographs were taken 24 hours post transfection. (B) The culture media supernatant collected from the cells transfected with the infectious BAC clones was used to infect Vero E6 cells. Immunofluorescent assay (IFA) was performed to detect infection and viral replication. Cells were fixed 24 hours post infection, and stained using rabbit antibody against the SARSr-CoV Rp3 nucleocapsid protein and a Cy3-conjugated anti-rabbit IgG.

(PPTX)

Click here for additional data file.(8.3M, pptx)

S8 Fig
Quantification of SARSr-CoV in individual bat fecal samples.
The number of genome copies of SARSr-CoV per gram of bat feces was determined by quantitative real-time PCR targeting the RdRp gene. Samples from which the SARSr-CoV RBD sequences were successfully amplified are indicated in red.

(PPTX)

Click here for additional data file.(374K, pptx)

S9 Fig
Spike substitution strategy.
The original fragments E and F were shortened to leave spike gene as an independent fragment. The new fragments were designated as Es and Fs. BsaI or BsmBI sites were introduced into the junctions of Es/Spike and Spike/Fs. Then any spike could be substituted into the genome of SARSr-CoV WIV1 through this strategy.

(TIF)

Click here for additional data file.(1.3M, tif)

S1 Table
Comparison of the novel bat SARSr-CoVs identified in this study with human/civet SARS-CoVs and previously described bat SARSr-CoVs.
(DOCX)

Click here for additional data file.(36K, docx)

S2 Table
Distribution of SARSr-CoVs highly similar to SARS-CoV in the variable S, ORF3 and ORF8 genes in the single cave.
(DOCX)

Click here for additional data file.(15K, docx)

S1 Dataset
Full-length genome sequences of bat SARSr-CoVs newly identified in this study.
(FAS)

Click here for additional data file.(326K, fas)

Acknowledgments

We thank Ji-Hua Zhou and Wei-Hong Yang from Yunnan Institute of Endemic Diseases Control and Prevention for the assistance in sample collection. We thank the Center for Instrumental Analysis and Metrology of Wuhan Institute of Virology, CAS, for the assistance in taking confocal microscope pictures (Dr. Ding Gao) and flow cytometry (Ms. Juan Min).

Funding Statement

This work was jointly funded by National Natural Science Foundation of China (81290341, 31621061) to ZLS, China Mega-Project for Infectious Disease (2014ZX10004001-003) to ZLS, Scientific and technological basis special project (2013FY113500) to YZZ and ZLS from the Ministry of Science and Technology of China, the Strategic Priority Research Program of the Chinese Academy of Sciences (XDPB0301) to ZLS, the National Institutes of Health (NIAID R01AI110964), the USAID Emerging Pandemic Threats (EPT) PREDICT program to PD and ZLS, CAS Pioneer Hundred Talents Program to JC, NRF-CRP grant (NRF-CRP10-2012-05) to LFW and WIV “One-Three-Five” Strategic Program (WIV-135-TP1) to JC and ZLS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability

All relevant data are within the paper and its Supporting Information files. The complete genome sequences of the 11 bat SARS-related coronaviruses newly identified in this study have been deposited in the GenBank database and assigned accession numbers KY417142 to KY417152, respectively.

References

1. Peiris JS, Guan Y, Yuen KY. Severe acute respiratory syndrome. Nat Med. 2004; 10: S88–97. doi: 10.1038/nm1143 [PMC free article] [PubMed] [Google Scholar]
2. Zhong NS, Zheng BJ, Li YM, Poon, Xie ZH, Chan KH, et al. Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People's Republic of China, in February, 2003. Lancet. 2003; 362: 1353–1358. [PMC free article] [PubMed] [Google Scholar]
3. Chinese SMEC. Molecular evolution of the SARS coronavirus during the course of the SARS epidemic in China. Science. 2004; 303: 1666–1669. doi: 10.1126/science.1092002 [PubMed] [Google Scholar]
4. Drexler JF, Corman VM, Drosten C. Ecology, evolution and classification of bat coronaviruses in the aftermath of SARS. Antiviral Res. 2014; 101: 45–56. doi: 10.1016/j.antiviral.2013.10.013 [PMC free article] [PubMed] [Google Scholar]
5. Marra MA, Jones SJ, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YS, et al. The Genome sequence of the SARS-associated coronavirus. Science. 2003; 300: 1399–1404. doi: 10.1126/science.1085953 [PubMed] [Google Scholar]
6. Snijder EJ, Bredenbeek PJ, Dobbe JC, Thiel V, Ziebuhr J, Poon LL, et al. Unique and conserved features of genome and proteome of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J Mol Biol. 2003; 331: 991–1004. [PMC free article] [PubMed] [Google Scholar]
7. Guan Y, Zheng BJ, He YQ, Liu XL, Zhuang ZX, Cheung CL, et al. Isolation and characterization of viruses related to the SARS coronavirus from animals in southern China. Science. 2003; 302: 276–278. doi: 10.1126/science.1087139 [PubMed] [Google Scholar]
8. Song HD, Tu CC, Zhang GW, Wang SY, Zheng K, Lei LC, et al. Cross-host evolution of severe acute respiratory syndrome coronavirus in palm civet and human. Proc Natl Acad Sci U S A. 2005; 102: 2430–2435. doi: 10.1073/pnas.0409608102 [PMC free article] [PubMed] [Google Scholar]
9. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, et al. Bats are natural reservoirs of SARS-like coronaviruses. Science. 2005; 310: 676–679. doi: 10.1126/science.1118391 [PubMed] [Google Scholar]
10. Lau SK, Woo PC, Li KS, Huang Y, Tsoi HW, Wong BH, et al. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci U S A. 2005; 102: 14040–14045. doi: 10.1073/pnas.0506735102 [PMC free article] [PubMed] [Google Scholar]
11. Tang XC, Zhang JX, Zhang SY, Wang P, Fan XH, Li LF, et al. Prevalence and genetic diversity of coronaviruses in bats from China. J Virol. 2006; 80: 7481–7490. doi: 10.1128/JVI.00697-06 [PMC free article] [PubMed] [Google Scholar]
12. Yuan J, Hon CC, Li Y, Wang D, Xu G, Zhang H, et al. Intraspecies diversity of SARS-like coronaviruses in Rhinolophus sinicus and its implications for the origin of SARS coronaviruses in humans. J Gen Virol. 2010; 91: 1058–1062. doi: 10.1099/vir.0.016378-0 [PubMed] [Google Scholar]
13. He B, Zhang Y, Xu L, Yang W, Yang F, Feng Y, et al. Identification of diverse alphacoronaviruses and genomic characterization of a novel severe acute respiratory syndrome-like coronavirus from bats in China. J Virol. 2014; 88: 7070–7082. doi: 10.1128/JVI.00631-14 [PMC free article] [PubMed] [Google Scholar]
14. Wu Z, Yang L, Ren X, He G, Zhang J, Yang J, et al. Deciphering the bat virome catalog to better understand the ecological diversity of bat viruses and the bat origin of emerging infectious diseases. ISME J. 2016; 10: 609–620. doi: 10.1038/ismej.2015.138 [PMC free article] [PubMed] [Google Scholar]
15. Drexler JF, Gloza-Rausch F, Glende J, Corman VM, Muth D, Goettsche M, et al. Genomic characterization of severe acute respiratory syndrome-related coronavirus in European bats and classification of coronaviruses based on partial RNA-dependent RNA polymerase gene sequences. J Virol. 2010; 84: 11336–11349. doi: 10.1128/JVI.00650-10 [PMC free article] [PubMed] [Google Scholar]
16. Tong S, Conrardy C, Ruone S, Kuzmin IV, Guo X, Tao Y, et al. Detection of novel SARS-like and other coronaviruses in bats from Kenya. Emerg Infect Dis. 2009; 15: 482–485. doi: 10.3201/eid1503.081013 [PMC free article] [PubMed] [Google Scholar]
17. Ge XY, Li JL, Yang XL, Chmura AA, Zhu G, Epstein JH, et al. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature. 2013; 503: 535–538. doi: 10.1038/nature12711 [PMC free article] [PubMed] [Google Scholar]
18. Yang XL, Hu B, Wang B, Wang MN, Zhang Q, Zhang W, et al. Isolation and Characterization of a Novel Bat Coronavirus Closely Related to the Direct Progenitor of Severe Acute Respiratory Syndrome Coronavirus. J Virol. 2016; 90: 3253–3256. [PMC free article] [PubMed] [Google Scholar]
19. Menachery VD, Yount BL Jr., Sims AC, Debbink K, Agnihothram SS, Gralinski LE, et al. SARS-like WIV1-CoV poised for human emergence. Proc Natl Acad Sci U S A. 2016; 113: 3048–3053. doi: 10.1073/pnas.1517719113 [PMC free article] [PubMed] [Google Scholar]
20. de Souza Luna LK, Heiser V, Regamey N, Panning M, Drexler JF, Mulangu S, et al. Generic detection of coronaviruses and differentiation at the prototype strain level by reverse transcription-PCR and nonfluorescent low-density microarray. J Clin Microbiol. 2007; 45: 1049–1052. doi: 10.1128/JCM.02426-06 [PMC free article] [PubMed] [Google Scholar]
21. Ren W, Li W, Yu M, Hao P, Zhang Y, Zhou P, et al. Full-length genome sequences of two SARS-like coronaviruses in horseshoe bats and genetic variation analysis. J Gen Virol. 2006; 87: 3355–3359. doi: 10.1099/vir.0.82220-0 [PubMed] [Google Scholar]
22. Lau SK, Feng Y, Chen H, Luk HK, Yang WH, Li KS, et al. Severe Acute Respiratory Syndrome (SARS) Coronavirus ORF8 Protein Is Acquired from SARS-Related Coronavirus from Greater Horseshoe Bats through Recombination. J Virol. 2015; 89: 10532–10547. doi: 10.1128/JVI.01048-15 [PMC free article] [PubMed] [Google Scholar]
23. Zeng LP, Gao YT, Ge XY, Zhang Q, Peng C, Yang XL, et al. Bat Severe Acute Respiratory Syndrome-Like Coronavirus WIV1 Encodes an Extra Accessory Protein, ORFX, Involved in Modulation of the Host Immune Response. J Virol. 2016; 90: 6573–6582. doi: 10.1128/JVI.03079-15 [PMC free article] [PubMed] [Google Scholar]
24. Li F. Evidence for a common evolutionary origin of coronavirus spike protein receptor-binding subunits. J Virol. 2012; 86: 2856–2858. doi: 10.1128/JVI.06882-11 [PMC free article] [PubMed] [Google Scholar]
25. Lau SK, Li KS, Huang Y, Shek CT, Tse H, Wang M, et al. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J Virol. 2010; 84: 2808–2819. doi: 10.1128/JVI.02219-09 [PMC free article] [PubMed] [Google Scholar]
26. Oostra M, de Haan CA, Rottier PJ. The 29-nucleotide deletion present in human but not in animal severe acute respiratory syndrome coronaviruses disrupts the functional expression of open reading frame 8. J Virol. 2007; 81: 13876–13888. doi: 10.1128/JVI.01631-07 [PMC free article] [PubMed] [Google Scholar]
27. Kopecky-Bromberg SA, Martinez-Sobrido L, Frieman M, Baric RA, Palese P. Severe acute respiratory syndrome coronavirus open reading frame (ORF) 3b, ORF 6, and nucleocapsid proteins function as interferon antagonists. J Virol. 2007; 81: 548–557. doi: 10.1128/JVI.01782-06 [PMC free article] [PubMed] [Google Scholar]
28. Chen CY, Ping YH, Lee HC, Chen KH, Lee YM, Chen YJ, et al. Open reading frame 8a of the human severe acute respiratory syndrome coronavirus not only promotes viral replication but also induces apoptosis. J Infect Dis. 2007; 196: 405–415. doi: 10.1086/519166 [PMC free article] [PubMed] [Google Scholar]
29. Yang L, Wu Z, Ren X, Yang F, He G, Zhang J, et al. Novel SARS-like betacoronaviruses in bats, China, 2011. Emerg Infect Dis. 2013; 19: 989–991. doi: 10.3201/eid1906.121648 [PMC free article] [PubMed] [Google Scholar]
30. Wu Z, Yang L, Ren X, Zhang J, Yang F, Zhang S, et al. ORF8-Related Genetic Evidence for Chinese Horseshoe Bats as the Source of Human Severe Acute Respiratory Syndrome Coronavirus. J Infect Dis. 2016; 213: 579–583. doi: 10.1093/infdis/jiv476 [PMC free article] [PubMed] [Google Scholar]
31. Drexler JF, Corman VM, Wegner T, Tateno AF, Zerbinati RM, Gloza-Rausch F, et al. Amplification of emerging viruses in a bat colony. Emerg Infect Dis. 2011; 17: 449–456. doi: 10.3201/eid1703.100526 [PMC free article] [PubMed] [Google Scholar]
32. Wang MN, Zhang W, Gao YT, Hu B, Ge XY, Yang XL, et al. Longitudinal surveillance of SARS-like coronaviruses in bats by quantitative real-time PCR. Virol Sin. 2016; 31: 78–80. doi: 10.1007/s12250-015-3703-3 [PMC free article] [PubMed] [Google Scholar]
33. Menachery VD, Yount BL Jr., Debbink K, Agnihothram S, Gralinski LE, Plante JA, et al. A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence. Nat Med. 2015; 21: 1508–1513. doi: 10.1038/nm.3985 [PMC free article] [PubMed] [Google Scholar]
34. Ren W, Qu X, Li W, Han Z, Yu M, Zhou P, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. J Virol. 2008; 82: 1899–1907. doi: 10.1128/JVI.01085-07 [PMC free article] [PubMed] [Google Scholar]
35. Sung SC, Chao CY, Jeng KS, Yang JY, Lai MM. The 8ab protein of SARS-CoV is a luminal ER membrane-associated protein and induces the activation of ATF6. Virology. 2009; 387: 402–413. doi: 10.1016/j.virol.2009.02.021 [PMC free article] [PubMed] [Google Scholar]
36. Freundt EC, Yu L, Park E, Lenardo MJ, Xu XN. Molecular determinants for subcellular localization of the severe acute respiratory syndrome coronavirus open reading frame 3b protein. J Virol. 2009; 83: 6631–6640. doi: 10.1128/JVI.00367-09 [PMC free article] [PubMed] [Google Scholar]
37. Zhou P, Li H, Wang H, Wang LF, Shi Z. Bat severe acute respiratory syndrome-like coronavirus ORF3b homologues display different interferon antagonist activities. J Gen Virol. 2012; 93: 275–281. doi: 10.1099/vir.0.033589-0 [PubMed] [Google Scholar]
38. Irwin DM, Kocher TD, Wilson AC. Evolution of the cytochrome b gene of mammals. J Mol Evol. 1991; 32: 128–144. [PubMed] [Google Scholar]
39. Mayer F, von Helversen O. Cryptic diversity in European bats. Proc Biol Sci. 2001; 268: 1825–1832. doi: 10.1098/rspb.2001.1744 [PMC free article] [PubMed] [Google Scholar]
40. Hall BG. Building phylogenetic trees from molecular data with MEGA. Mol Biol Evol. 2013; 30: 1229–1235. doi: 10.1093/molbev/mst012 [PubMed] [Google Scholar]
41. Martin DP, Lemey P, Lott M, Moulton V, Posada D, Lefeuvre P. RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics. 2010; 26: 2462–2463. doi: 10.1093/bioinformatics/btq467 [PMC free article] [PubMed] [Google Scholar]
42. Lole KS, Bollinger RC, Paranjape RS, Gadkari D, Kulkarni SS, Novak NG, et al. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol. 1999; 73: 152–160. [PMC free article] [PubMed] [Google Scholar]
43. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010; 59: 307–321. doi: 10.1093/sysbio/syq010 [PubMed] [Google Scholar]
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 7:42 am

Part 1 of 3

Lab-Made? SARS-CoV-2 Genealogy Through the Lens of Gain-of-Function Research
by Yuri Deigin
Apr 22, 2020

NOTICE: THIS WORK MAY BE PROTECTED BY COPYRIGHT

YOU ARE REQUIRED TO READ THE COPYRIGHT NOTICE AT THIS LINK BEFORE YOU READ THE FOLLOWING WORK, THAT IS AVAILABLE SOLELY FOR PRIVATE STUDY, SCHOLARSHIP OR RESEARCH PURSUANT TO 17 U.S.C. SECTION 107 AND 108. IN THE EVENT THAT THE LIBRARY DETERMINES THAT UNLAWFUL COPYING OF THIS WORK HAS OCCURRED, THE LIBRARY HAS THE RIGHT TO BLOCK THE I.P. ADDRESS AT WHICH THE UNLAWFUL COPYING APPEARED TO HAVE OCCURRED. THANK YOU FOR RESPECTING THE RIGHTS OF COPYRIGHT OWNERS.


Image
Staff celebrating the physical completion of the laboratory in 2015, Wuhan, China (Source)

If you hear anyone claim “we know the virus didn’t come from a lab”, don’t buy it — it may well have. Labs around the globe have been creating synthetic viruses like CoV2 for years. And no, its genome would not necessarily contain hallmarks of human manipulation: modern genetic engineering tools permit cutting and pasting genomic fragments without leaving a trace. It can be done quickly, too: it took a Swiss team less than a month to create a synthetic clone of CoV2.


How I Learned to Start Worrying

Oh, come on. Lab-made? Nonsense! Back in January, that was my knee-jerk reaction when ideas that Covid-19 is caused by a laboratory leak had just surfaced. Bioweapon? Well, that is just Flat Earth crazies territory. Thus, whenever I kept hearing anything about non-natural origins of SARS-CoV-2, I brushed it aside under similar sentiments. So what if there is a virology institute in Wuhan? Who knows how many of those are sprinkled throughout China.

At some point, it became necessary to brush such theories aside in a substantiated manner, as their proponents began to back up their theses about the possible artificial nature of the virus with arguments from molecular biology, and when engaging them in debate, I wanted to smash their conspiracy theories with cold, hard scientific facts. Just like that Nature paper (or so I thought).

So it was then, in pursuit of arguments against the virus’s lab-madeness, that I got infected by the virus of doubt. What was the source of my doubts? The fact that the deeper you dive into the research activities of coronavirologists over the past 15–20 years, the more you realize that creating chimeras like CoV2 was commonplace in their labs.

A chimera virus is defined by the Center for Veterinary Biologics (part of the U.S. Department of Agriculture's Animal and Plant Health Inspection Service) as a "new hybrid microorganism created by joining nucleic acid fragments from two or more different microorganisms in which each of at least two of the fragments contain essential genes necessary for replication." The term chimera already referred to an individual organism whose body contained cell populations from different zygotes or an organism that developed from portions of different embryos. In mythology, a chimera is a creature such as a hippogriff or a gryphon formed from parts of different animals, thus the name for these viruses. Chimeric flaviviruses have been created in an attempt to make novel live attenuated vaccines.

-- Chimera (virus), by Wikipedia


And CoV2 is an obvious chimera (though not necessarily a lab-made one), which is based on the ancestral bat strain RaTG13, in which the receptor binding motif (RBM) in its spike protein is replaced by the RBM from a pangolin strain, and in addition, a small but very special stretch of 4 amino acids is inserted, which creates a furin cleavage site that, as virologists have previously established, significantly expands the “repertoire” of the virus in terms of whose cells it can penetrate. Most likely, it was thanks to this new furin site that the new mutant managed to jump species from its original host to humans.

Indeed, virologists, including the leader of coronavirus research at the Wuhan Institute of Virology, Shi Zhengli, have done many similar things in the past — both replacing the RBM in one type of virus by an RBM from another, or adding a new furin site that can provide a species-specific coronavirus with an ability to start using the same receptor (e.g. ACE2) in other species. In fact, Shi Zhengli’s group was creating chimeric constructs as far back as 2007 and as recently as 2017, when they created a whole of 8 new chimeric coronaviruses with various RBMs. In 2019 such work was in full swing, as WIV was part of a $3.7 million NIH grant titled Understanding the Risk of Bat Coronavirus Emergence. Under its auspices, Shi Zhengli co-authored a 2019 paper that called for continued research into synthetic viruses and testing them in vitro and in vivo:

Currently, no clinical treatments or prevention strategies are available for any human coronavirus. Given the conserved RBDs of SARS-CoV and bat SARSr-CoVs, some anti-SARS-CoV strategies in development, such as anti-RBD antibodies or RBD-based vaccines, should be tested against bat SARSr-CoVs. Recent studies demonstrated that anti-SARS-CoV strategies worked against only WIV1 and not SHC014. In addition, little information is available on HKU3-related strains that have much wider geographical distribution and bear truncations in their RBD. Similarly, anti-S antibodies against MERS-CoV could not protect from infection with a pseudovirus bearing the bat MERSr-CoV S. Furthermore, little is known about the replication and pathogenesis of these bat viruses. Thus, future work should be focused on the biological properties of these viruses using virus isolation, reverse genetics and in vitro and in vivo infection assays. The resulting data would help the prevention and control of emerging SARS-like or MERS-like diseases in the future.


If the above quote might seem vague as to what exactly “using reverse genetics” might mean, the NIH grant itself spells it out:

Aim 3. In vitro and in vivo characterization of SARSr-CoV spillover risk, coupled with spatial and phylogenetic analyses to identify the regions and viruses of public health concern. We will use S protein sequence data, infectious clone technology, in vitro and in vivo infection experiments and analysis of receptor binding to test the hypothesis that % divergence thresholds in S protein sequences predict spillover potential.


“Infectious clone technology” stands for creating live synthetic viral clones. Considering the heights of user friendliness and automation that genetic engineering tools have attained, creating a synthetic CoV2 via the above methodology would be in reach of even a grad student.

But before delving into CoV2 origins, let’s first take a quick dive into its biology.

Biology

Ok, let’s start from the basics. What’s a furin site, an RBM, or a spike protein? Bear with me: once you wade through the jungle of terminology, conceptually, everything is pretty straightforward. For example, spike proteins are those red things sticking out of a virus particle — the very reason for which these viruses got “crowned”:

Image

It is with the help of these proteins that the virion clings to the receptor of the victim cell (ACE2 in our case) to then penetrate inside. So it is a vitally important part of the virus, as without getting into a cell viruses cannot replicate. The spike protein also determines which animals the virus can or cannot infect, as ACE2 receptors (or other targets for other viruses) in different species can differ in structure. At the same time, out of the entire 30 kilobase genome (quite huge by viral standards), the gene of this protein makes up only 12–13%. So the spike protein is only about 1300 amino acids long. Below is how the spike (S) protein is structured in CoV2 and close relatives:

Image

As can be seen from the figure above, the S protein consists of two subunits: S1 and S2. It is S1 that interacts with the ACE2 receptor, and the place where S1 does so is called Receptor Binding Domain (RBD), while the area of direct contact, the holy of holies, is called Receptor Binding Motif (RBM). Here is a beautiful illustration from an equally beautiful work:

Image
Overall structure of 2019-nCoV RBD bound with ACE2.
(a) Overall topology of 2019-nCoV spike monomer. NTD, N-terminal domain. RBD, receptor-binding domain. RBM, receptor-binding motif. SD1, subdomain 1. SD2, subdomain 2. FP, fusion peptide. HR1, heptad repeat 1. HR2, heptad repeat 2. TM, transmembrane region. IC, intracellular domain.
(b) Sequence and secondary structures of 2019-nCoV RBD. The RBM is colored red.
© Overall structure of 2019-nCoV RBD bound with ACE2. ACE2 is colored green. 2019-nCoV RBD core is colored cyan and RBM is colored red. Disulfide bonds in the 2019-nCoV RBD are shown as stick and indicated by yellow arrows. The N-terminal helix of ACE2 responsible for binding is labeled.


When the CoV2 genome was just sequenced and made publicly available on January 10, 2020, it was a riddle, as no closely related strains were known. But quite quickly, on January 23, Shi Zhengli released a paper indicating that CoV2 is 96% identical to RaTG13, a strain which her laboratory had previously isolated from Yunnan bats in 2013. However, outside of her lab, no one knew about that strain until January 2020.

It was immediately clear that RaTG13 is special. Take a look at the figure below:

Image

This is a genome similarity graph between CoV2 and other known strains. The higher the curve, the higher the percentage of matching nucleotides. As you can see, in the spike protein (S) gene region (between nucleotides 22k and 25k), only RaTG13 is more or less close to CoV2, while all other strains take a deep dive around this spot — both strains from other bats and the first SARS-CoV (red curve). This in itself is far from suspicious — who knows how many unknown SARS-like strains lurk in the bat caves of Yunnan? Ok, maybe it is not very clear how exactly the virus could get from there to Wuhan, but hey, with those wet markets you never know.

Pangolins

Next, pangolins appeared on the scene: in February, another group of Chinese scientists discovered a peculiar strain of pangolin coronavirus in their possession, which, while generally being only 90% similar to CoV2, in the RBM region was almost identical to it, with only a single amino acid difference (see the upper two sequences, dots indicate a match with the top sequence):

Image

Surprisingly, in the first quarter of the S protein, the pangolin strain is highly dissimilar from CoV2, but after the RBM all three strains (CoV2, Pangolin, RaTG13) exhibit a shared high degree of similarity. Most strikingly, RaTG13’s RBM itself is quite different than that of CoV2, which can be seen from the steep dive of the green RaTG13 graph compared to the red CoV2 graph in the RBM region (pink strip) in the following graph:

Image

This observation is confirmed by the phylogenetic analysis of the three areas highlighted in the graph above — in the RBM, the pangolin strain is closer to CoV2 than is RaTG13, but it is RaTG13 that is closer to CoV2 to the left and right of RBM. So there is obvious recombination, as the authors (and other papers) conclude.

Genetic recombination (also known as genetic reshuffling) is the exchange of genetic material between different organisms which leads to production of offspring with combinations of traits that differ from those found in either parent.

-- Genetic recombination, by Wikipedia


How did the researchers obtain those pangolins? This is how:

Image

They were confiscated from smugglers by Chinese customs and transferred to an animal rehab center in Guangdong, where they died while exhibiting severe coronavirus symptoms. This, of course, must have gotten the attention of local virologists, who took several samples:

Pangolins used in the study were confiscated by Customs and Department of Forestry of Guangdong Province in March-December 2019. They include four Chinese pangolins (Manis pentadactyla) and 25 Malayan pangolins (Manis javanica). These animals were sent to the wildlife rescue center, and were mostly inactive and sobbing, and eventually died in custody despite exhausting rescue efforts. Tissue samples were taken from the lung, lymph nodes, liver, spleen, muscle, kidney, and other tissues from pangolins that had just died for histopathological and virological examinations.


Those pangolins attracted the attention of other virologists too. For example, a team in Hong Kong also received samples of confiscated pangolins and in February 2020 they also released a paper that noted clear signs of recombination in the CoV2 spike protein:

We received frozen tissue (lungs, intestine, blood) samples that were collected from 18 Malayan pangolins (Manis javanica) during August 2017-January 2018. These pangolins were obtained during the anti-smuggling operations by Guangxi Customs. Strikingly, high-throughput sequencing of their RNA revealed the presence of coronaviruses in six (two lung, two intestine, one lung-intestine mix, one blood) of 43 samples. With the sequence read data, and by filling gaps with amplicon sequencing, we were able to obtain six full or nearly full genome sequences — denoted GX/P1E, GX/P2V, GX/P3B, GX/P4L, GX/P5E and GX/P5L — that fall into the 2019-CoV2 lineage (within the genus Betacoronavirus) in a phylogenetic analysis (Figure 1a).



More notable, however, was the observation of putative recombination signals between the pangolins coronaviruses, bat coronaviruses RaTG13, and human 2019-CoV2 (Figure 1c, d). In particular, 2019-CoV2 exhibits very high sequence similarity to the Guangdong pangolin coronaviruses in the receptor-binding domain (RBD; 97.4% amino acid similarity; indicated by red arrow in Figure 1c and Figure 2a), even though it is most closely related to bat coronavirus RaTG13 in the remainder of the viral genome. Bat CoV RaTG and the human 2019-CoV2 have only 89.2% amino acid similarity in RBD. Indeed, the Guangdong pangolin coronaviruses and 2019-CoV2 possess identical amino acids at the five critical residues of the RBD, whereas RaTG13 only shares one amino acid with 2019-CoV2 (residue 442, human SARS-CoV numbering).


By the way, the authors of this article also highlighted the high phylogenetic mosaicity of the CoV2 spike protein:

Interestingly, a phylogenetic analysis of synonymous sites alone in the RBD revealed that the phylogenetic position of the Guangdong pangolin is consistent with that in the remainder of the viral genome, rather than being the closest relative of 2019-CoV2 (Figure 2b). Hence, it is possible that the amino acid similarity between the RBD of the Guangdong pangolin coronaviruses and 2019-CoV2 is due to selectively-mediated convergent evolution rather than recombination, although it is difficult to choose between these scenarios on current data.


Translated from science-speak, what this means is that if we analyze the entire RBD of the three strains, ignoring the obvious differences (i.e. non-synonymous substitutions) among them, which are mainly found in the RBM (which, recall, is identical between CoV2 and Pangolin), and construct a phylogenetic tree for synonymous substitutions, CoV2 is still closer to RaTG13 than to the pangolin strain. Which is rather strange in light of the fact that the pangolin strain and CoV2 have identical RBMs (which are segments inside RBD).

The authors go on to put forth a conjecture that this may be the result of convergent evolution, in other words, that CoV2 and the pangolin strain came to possess identical RBMs each in their own way, rather than through recombination between common ancestors. Because it would have required a rather unique recombination event — as if someone cut out a precise RBM segment from a pangolin strain and used it to replace the RBM in RaTG13. Talk about Intelligent Design!

Royal Genealogy

In order to better understand CoV2 origins, let’s take a look at spike protein sequences of our Unholy Trinity: CoV2, RaTG13 and MP789 (pangolin-2019). Let’s compare the pairwise differences between them (identical amino acids are marked with dots, red letters denote differences, and dashes indicate deleted/inserted amino acids):

Image

The comparisons illustrate what previously quoted papers have noted: that in the first quarter of the sequence, the pangolin strain is far from CoV2 and RaTG1, and if it weren’t for the RBM region (red rectangle), RaTG13 would have been very close to CoV2. But, as I already said, the RBM in CoV2 is closest to that of the pangolin strain.

What about other pangolin strains? So far we’ve only analyzed the MP789 strain isolated from pangolins confiscated by customs in 2019. But there was another batch of pangolins confiscated in 2017, and they also had a similar coronavirus strain isolated. Let’s compare it to RaTG13 and MP789:

Image

In the first quarter of the S protein, the 2017 pangolin strains are closer to RaTG13 (and CoV2) than their 2019 pangolin counterpart (MP789). At the same time, all three have a clear recent common ancestor in the areas marked by green rectangles, and in these areas RaTG13 and pangolin-2019 (MP789) are closer to each other than to pangolin-2017, since they have several common mutations (marked by red and blue ellipses), which are absent from pangolin-2017. But the RBM for all three is different, and different in approximately the same proportion, and in similar places.

Maybe after ancestors of RaTG13 and MP789 diverged, the MP789 ancestor had the first quarter of its protein replaced (which did not occur in RaTG13 or pangolin-2017), and the rest of the protein remained common for all three strains. Later the paths of the RaTG13 and MP789 gene pools crossed again and produced CoV2. It is also possible that the ancestor of RaTG13 arose as a result of recombination of ancestral pangolin strains.

It is also interesting to see a rather unique identical mutation (QTQTNS) in RaTG13 and pangolin-2019 right in front of the spot where CoV2 has a new furin cleavage site. That furin site, as I mentioned, arose via an insertion of 4 new amino acids (PRRA). If we look at the nucleotide sequence around this insertion, we can see that RaTG13 and CoV2 are closer to each other in that area than to pangolin-2019, since they possess several common mutations (highlighted in blue):

Image

By the way, Orf1ab is also a phylogenetic mess in CoV2: 1a is closer to RaTG13, but 1b is closer to pangolin-2019:

Image
(Image Source)

Does this mean that the ancestor of CoV2 crossed with the common ancestor of pangolin-19 at least twice? First, when it (along with a common ancestor of RaTG13) inherited Orf1ab and the second half of the spike protein with the QTQTNS mutation, and second time when it acquired 1b and RBM, which differ from RaTG13. All of this is certainly possible in nature — after all, these viruses mutate and recombine constantly. Another question is where exactly bat and pangolin viruses are most likely to encounter one another for such orgies — in mountain caves, “wet markets”, shelters for confiscated animals, or even in laboratories. But let’s put those questions aside for now. First, let's discuss what is arguably the most eye-catching aspect of the new virus — a 4-amino acid insertion that turned it into a natural-born killer.

A Killer Intro

It is impossible to ignore the introduction of a PRRA insert between S1 and S2: it sticks out like a splinter. This insert creates the furin cleavage site, which I mentioned at the very beginning. Let me explain what a furin site is. Remember the structure of our spike protein? Here is a detailed diagram:

Image

The protein consists of two parts, S1 and S2, of which S1 is responsible for primary contact with the receptor (recall Receptor Binding Domain / Motif), and S2 is responsible for fusion with the cell membrane and penetration into the cell. The fusion process is started by the fusion peptide marked in yellow, but in order for it to engage in its dirty deed, someone must cut the S protein at one of the sites marked by diamonds in the diagram above. The virus does not have its own such “cutters”, so it relies on various proteases of its victims. There are several types of such proteases, as can be deduced from the abundance of colors of those diamonds. But not all proteases are equal, and not all types of cells have proteases needed by the virus. Furin is one of the most effective, and it is found not only on the surface of cells, but also inside. Most clearly, the danger of the new furin site is demonstrated by the difference between CoV2 and its grandpa, SARS-CoV:

Image

As can be seen from the diagram, in the case of CoV2, thanks to the furin site, it is not two, but three classes of proteases (three colored PacMans) that can cut its S protein outside the cell. But perhaps the most important difference is that furin is also present inside the cell, so it can cut the S protein immediately after virion assembly, thereby providing new virions with the ability to merge with new cells right off the bat (no pun intended).

The importance of the new furin site in CoV2’s virulence was recently demonstrated by a study in hamsters where the disappearance of the furin site (due to a mutation) greatly decreased mutant CoV2’s pathogenicity and replication ability:


Infection of hamsters shows that one of the variants (Del-mut-1) which carries deletion of 10 amino acids (30 bp) does not cause the body weight loss or more severe pathological changes in the lungs that is associated with wild type virus infection.


Image
Virus replication in the lung tissues of hamsters infected with either WT or Del-mut-1 SARS-CoV-2 virus. Virus titration by plaque assay of lung and tracheal tissues collected on day 2 and 4 post-infection

The good news is that there already exist various furin and other protease inhibitors, and some of them (like camostat and its analogs) are already being clinically tested against CoV2.

By the way, it is possible that the new furin site could also be largely responsible for the pronounced age-dependent morbidity and mortality of CoV2:

Patients with hypertension, diabetes, coronary heart disease, cerebrovascular illness, chronic obstructive pulmonary disease, and kidney dysfunction have worse clinical outcomes when infected with SARS-CoV-2, for unknown reasons. The purpose of this review is to summarize the evidence for the existence of elevated plasmin(ogen) in COVID-19 patients with these comorbid conditions. Plasmin, and other proteases, may cleave a newly inserted furin site in the S protein of SARS-CoV-2, extracellularly, which increases its infectivity and virulence.


Plasmin is an important enzyme (EC 3.4.21.7) present in blood that degrades many blood plasma proteins, including fibrin clots...

Plasmin is a serine protease that acts to dissolve fibrin blood clots. Apart from fibrinolysis, plasmin proteolyses proteins in various other systems: It activates collagenases, some mediators of the complement system, and weakens the wall of the Graafian follicle, leading to ovulation. It cleaves fibrin, fibronectin, thrombospondin, laminin, and von Willebrand factor. Plasmin, like trypsin, belongs to the family of serine proteases.

-- Plasmin, by Wikipedia


Furin cuts proteins in strictly defined places, namely after an RxxR sequence (that is, Arg-X-X-Arg, where X can be any amino acid). Moreover, if arginine is also in the second or third place (that is, RRxR or RxRR), then the cleavage efficiency is significantly increased.

Therefore, the appearance of a new furin cleavage site was noticed immediately, as none of the closest or even distant relatives of Cov2 have such a site
— those coronaviruses that do, share only 40% of their genome with Cov2:

It was found that all Spike with a SARS-CoV-2 Spike sequence homology greater than 40% did not have a furin cleavage site (Figure 1, Table 1), including Bat-CoV RaTG13 and SARS-CoV (with sequence identity as 97.4% and 78.6%, respectively). The furin cleavage site “RRAR” in SARS-CoV-2 is unique in its family, rendering by its unique insert of “PRRA”. The furin cleavage site of SARS-CoV-2 is unlikely to have evolved from MERS, HCoV-HKU1, and so on. From the currently available sequences in databases, it is difficult for us to find the source. Perhaps there are still many evolutionary intermediate sequences waiting to be discovered.


Here is a great illustration from the source article of the quote above. Coronaviruses with a furin site are marked in pink, 3 different strains of Cov2 are shown at 10 o’clock:

Image

The closest relative with a furin site is the HKU5 strain, isolated by the Shi Zhengli team in 2014 in Guangzhou from bats of the genus Pipistrellus (added to GenBank in 2018). But it is a very distant relative — their spike proteins share only 36%.

So the virologists are puzzled. Where did this 12 nucleotide insert come from? Could it be lab-made? Well, virologists have studied furin sites in coronaviruses for decades, and have introduced many artificial ones in a lab. For example, an American team had inserted RRSRR into the spike protein of the first SARS-CoV back in 2006:


To investigate whether proteolytic cleavage at the basic amino acid residues, were it to occur, might facilitate cell–cell fusion activity, we mutated the wild-type SARS-CoV glycoprotein to construct a prototypic furin recognition site (RRSRR) at either position.


Image

And the Japanese have inserted a similar site (RRKR) into the SARS-CoV protein in 2008, though a bit downstream than in CoV2:

Image
Schematic illustration of SARS-CoV wt-S protein and its mutant (cl-S). S proteins are shown in the box, in which the RBD, putative fusion peptide (FP), two HRs, and transmembrane region (TM) are indicated. Cleavage sites by trypsin (Try-CS) and CPL (CPL-CS) are also shown. Amino acid positions 798 and 799 are changed into arginine to make the recognition sequence of furin-like protease, KRRKR. Nineteen C-terminal amino acids (aa) are deleted for the efficient psuedotype formation of VSV.

In the same year 2008, their Dutch colleagues also studied these protease sites of SARS-CoV and compared them to the murine coronavirus MHV, which also has such a site (SRRAHR | SV), one that is quite similar to the site of CoV2 (SPRRAR | SV):

Image

In 2009, another American group also worked on “improving” SARS-CoV and, continuing the American tradition of not penny-pinching on arginines, they inserted as many as 4 of them (RRSRR):

To examine the potential use of the SARS-CoV S1–S2 and S2′ positions as sites for proteolytic cleavage, we first introduced furin cleavage recognition sites at these locations by making the following mutations 664-SLLRSTSQSI — SLLRRSRRSI-671 (S1–S2) and 792-LKPTKRSF — LKRTKRSF-799 (S2′).


Beijing 2019

But the most recent work of this kind that I came across was an October 2019 paper from several Beijing labs, where the new furin site RRKR was inserted into not just some pseudovirus, but into an actual live chicken coronavirus, infectious bronchitis virus (IBV):

Image

An interesting side note is that, as the authors point out, the addition of a furin site allows the mutant virus to infect nerve cells. Perhaps the CoV2 furin site is the reason why some patients with CoV2 exhibit neurological symptoms, including loss of smell:

Mutation of the S2' site of QX genotype (QX-type) spike protein (S) in a recombinant virus background results in higher pathogenicity, pronounced neural symptoms and neurotropism when compared with conditions in wild-type IBV (WT-IBV) infected chickens. In this study, we present evidence suggesting that recombinant IBV with a mutant S2' site (furin-S2' site) leads to higher mortality. Infection with mutant IBV induces severe encephalitis and breaks the blood–brain barrier.



In summary, our results demonstrate that the furin cleavage site upstream of the FP in S protein is an important site for CoV, modulating entry, cell–virus fusion, adaptation to its host cell, cell tropism and pathogenicity, but not antigenicity.


Encephalitis is inflammation of the brain. There are several causes, but the most common is a viral infection.

Encephalitis often causes only mild flu-like signs and symptoms — such as a fever or headache — or no symptoms at all. Sometimes the flu-like symptoms are more severe. Encephalitis can also cause confused thinking, seizures, or problems with movement or with senses such as sight or hearing.

In some cases, encephalitis can be life-threatening. Timely diagnosis and treatment are important because it's difficult to predict how encephalitis will affect each individual.

Encephalitis, by Mayo Clinic


To be clear, many coronaviruses have naturally occurring furin sites, and they are very diverse. Obviously, they can appear as a result of random mutations. This is what happened in the case of MERS, as was pointed out in 2015 by an international team of authors, including Shi Zhengli and Ralph Baric, two stars of synthetic coronavirusology. We will come back to them many times, but for now, a few words about that article. In it the authors have shown that just two mutations allowed MERS to jump from bats to humans, and one of these mutations created a furin site. Though it was not an insertion of new amino acids, but a mutation of an existing one (marked in red on the left below):

Image

The authors did not just show this, but actually introduced these mutations back into the original bat strain: they created the same furin site and showed that it enables the bat strain to infect human cells:

To evaluate the potential genetic changes required for HKU4 to infect human cells, we reengineered HKU4 spike, aiming to build its capacity to mediate viral entry into human cells. To this end, we introduced two single mutations, S746R and N762A, into HKU4 spike. The S746R mutation was expected to restore the hPPC motif in HKU4 spike, whereas the N762A mutation likely disrupted the potential N-linked glycosylation site in the hECP motif in HKU4 spike.



We examined the capability of the mutant HKU4 spike to mediate viral entry into three types of human cells (Fig. 3A for HEK293T cells; data not shown for Huh-7 and MRC-5 cells), using a pseudovirus entry assay as previously described (14). In the absence of exogenous protease trypsin, HKU4 pseudoviruses bearing either the reengineered hPPC motif or the reengineered hECP motif were able to enter human cells, whereas HKU4 pseudoviruses bearing both of the reengineered human protease motifs entered human cells as efficiently as when activated by exogenous trypsin (Fig. 3A). In contrast, wild-type HKU4 pseudoviruses failed to enter human cells. Therefore, the reengineered hPPC and hECP motifs enabled HKU4 spike to be activated by human endogenous proteases and thereby allowed HKU4 pseudoviruses to bypass the need for exogenous proteases to enter human cells. These results reveal that HKU4 spike needs only two single mutations at the S1/S2 boundary to gain the full capacity to mediate viral entry into human cells.


By the way, how they did it might frighten those who aren’t familiar with modern biotechnology — because the authors inserted this coronavirus spike-like protein into inactivated HIV:

Briefly, MERS-CoV-spike-pseudotyped retroviruses expressing a luciferase reporter gene were prepared by cotransfecting HEK293T cells with a plasmid carrying Env-defective, luciferase-expressing HIV-1 genome (pNL4–3.luc.R-E-) and a plasmid encoding MERS-CoV spike protein.


Perhaps this is what prompted Indian researchers to look for sequences similar to HIV in the CoV2 genome (but their preprint was quickly criticized for bad methodology and erroneous conclusions). In fact, experts use such pseudoviruses regularly, and in general, one should not be scared of retroviruses as a class — their subspecies lentiviruses have been used for gene therapy for many years.

Where Did RaTG13 Come From?

RaTG13 is a very unusual strain. Odd to see that Shi Zhengli’s group was silent about it for all these years. After all, it is very different from its SARS-like siblings, especially in the spike protein, which is precisely what determines which types of cells (and in which animals) this virus can infect. Here is a genome similarity graph of CoV2 compared to other bat coronaviruses (panel B):

Image

The red curve represents RaTG13 while the blue curve is for the strains closest to RaTG13 (ZXC21 and ZC45). These strains were isolated from Chinese horseshoe bats (Rhinolophus sinicus) in Zhoushan in 2015 (ZXC21) and 2017 (ZC45). As can be seen from the above graph, even they differ in their S proteins from RaTG13. A direct sequence comparison illustrates this difference best:

Image

As we can see, the spike proteins of ZXC21 and ZC45 are not only 23–24 amino acid residues shorter than the RaTG13 protein, but they are shorter in the most important place — in the RBM (note the deletions in the red box marked with red dashes).

So where did RaTG13 come from? As I already mentioned, in 2020 Shi Zhengli reported that she isolated it in 2013 from Yunnan horseshoe bats (from Rhinolophus affinis, not the usual suspects R. sinicus). But until January 2020, this strain’s existence was not known, and here is how Shi Zhengli’s group described their discovery about RaTG13’s similarity to CoV2:

We then found that a short region of RNA-dependent RNA polymerase (RdRp) from a bat coronavirus (BatCoV RaTG13) — which was previously detected in Rhinolophus affinis from Yunnan province — showed high sequence identity to 2019-CoV2. We carried out full-length sequencing on this RNA sample (GISAID accession number EPI_ISL_402131). Simplot analysis showed that 2019-CoV2 was highly similar throughout the genome to RaTG13 (Fig. 1c), with an overall genome sequence identity of 96.2%.


Not much detail: previously detected, and that is that. Moreover, the quote seems to imply that until 2020, they only sequenced a part of its genome, the RdRp gene (which is part of Orf1b that precedes the spike protein gene). Ok, but where exactly in Yunnan was it obtained? The paper doesn’t mention it, and neither does GenBank. However, the GISAID entry seems to have a bit more info: collected in Pu’er City from a male bat’s fecal swab:

Image

This rang a bell, as in my wanderings around Pubmed, I had already encountered an expedition to Pu’er in the summer of 2013:

Bats were captured from various locations in five counties of four prefectures of Yunnan Province, China, from May to July 2013.


Image
Map showing five locations of bat sampling in four autonomous prefectures in Yunnan Province, China. Sampling locations in Yunnan are in red. The location of SARSr-Rs-BatCoV strains Rs3367 and RsSHC014, detected in a previous study (42), is in blue.

Researchers did not report anything particularly interesting for us from that expedition, but maybe it was then that Shi Zhengli or someone from her group obtained the RaTG13 sample? Which they sequenced only partially, and for some reason decided not to publish, although it was very different from everything known before.

By the way, Shi Zhengli could well have personally participated in that expedition, as she expressed great fondness when describing them — for example, in her TED-like talk in 2018, where she showed personal photos from such expeditions:


CREATOR OF NEW CORONAVIRUS? WUHAN INSTITUTE OF VIROLOGY

Moreover, it was a series of exactly such expeditions that brought Shi Zhengli worldwide fame and a “Batwoman” moniker: in a 2013 Nature paper, her group triumphantly announced that in Yunnan caves they had discovered carrier bats of the RsSHC014 and Rs3367 strains that coincided with the first SARS-CoV by 85% and 96%, respectively.

It is quite a coincidence that around the same time in Yunnan, Shi Zhengli’s group also discovered RaTG13, the closest strain to CoV2, and the two also share 96% of their genomes.


UPD: Is RaTG13 the same as RaBtCoV/4991?

[UPDATED] After I had published this post, I was pointed to this preprint that alleges that RaTG13 is, in fact, RaBtCoV/4991 (KP876546), which Shi Zhengli had previously reported discovering in an abandoned mineshaft in Yunnan in 2013. There indeed are several reasons to think so. First and foremost, the only published sequence for RaBtCoV/4991 is 100% identical to that of RaTG13 at the nucleotide level, albeit being just a 370-bp stretch of the RdRp gene:

BtCoV/4991 was first described in 2016. It is a 370 nucleotide virus fragment collected from the Mojiang mine in 2013 by the lab of Zeng-li Shi at the WIV [Wuhan Institute of Virology] (Ge et al., 2016). BtCoV/4991 is 100% identical in sequence to one segment of RaTG13. RaTG13 is a complete viral genome sequence (almost 30,000 nucleotides) that was only published in 2020, after the pandemic began (P. Zhou et al., 2020).

Despite the confusion created by their different names, in a letter obtained by us Zheng-li Shi confirmed to a virology database that BtCoV/4991 and RaTG13 are both from the same bat faecal sample and the same mine. They are thus sequences from the same virus...

Why did the Shi lab not acknowledge the miners’ deaths in any paper describing samples taken from the mine (Ge et al., 2016 and P. Zhou et al., 2020)? Why in the title of the Ge at al. 2016 paper did the Shi lab call it an “abandoned” mine? When they published the sequence of RaTG13 in Feb. 2020, why did the Shi lab provide a new name (RaTG13) for BtCoV/4991 when they had by then cited BtCoV/4991 twice in publications and once in a genome sequence database and when their sequences were from the same sample and 100% identical (P. Zhou et al., 2020)? If it was just a name change, why no acknowledgement of this in their 2020 paper describing RaTG13 (Bengston, 2020)? These strange and unscientific actions have obscured the origins of the closest viral relatives of SARS-CoV-2, viruses that are suspected to have caused a COVID-like illness in 2012 and which may be key to understanding not just the origin of the COVID-19 pandemic but the future behaviour of SARS-CoV-2.


-- A Proposed Origin for SARS-CoV-2 and the COVID-19 Pandemic [W/Comments], by Jonathan Latham, PhD and Allison Wilson, PhD


Image

Second, the collection details of the two strains are nearly identical: both were collected in July 2013 from a fecal swab of R. affinis bats:

Image

RaBtCoV/4991 was collected in a mineshaft located in the Mojiang county, which is under the jurisdiction of Pu’er City:

Mojiang Hani Autonomous County is an autonomous county under the jurisdiction of Pu’er City, in the south of Yunnan Province, China.

-- Wikipedia


And Pu’er City is listed as the collection location of RaTG13 at the GISAID database, which could well be an approximation for the Mojiang mineshaft.

It is odd that in her 2020 paper on RaTG13 Shi Zhengli fails to mention RaBtCoV/4991 or cite her 2016 paper about its discovery, for which she is listed as the one who “designed and coordinated the study”. It is not like RaBtCoV/4991 was forgotten by her group, as it is mentioned in their 2019 paper, where it is included in a phylogenetic tree of other coronaviruses:

Image

Sampling map (A) and phylogenetic analysis of CoVs detected in Rhinolophus bats (B). A total of 19 provinces (indicated in gray) in China were involved. 1. Beijing (BJ), 2. Chongquing (CA); 3. Fujian (FJ); 4. Gansu (GS); 5. Guangdong (GD); 6. Guangxi (BX); 7. Guizhou (GZ); 8. Hainan (HaN); 9. Hebei (HeB); 10. Henan (HeN); 11. Hubei (HuB); 12. Hunan (HuN); 13. Jiangsu (JS); 14. Shandong (SD); 15. Shanxi (SX); 16. Sichuan (SC); 17. Tibet (T); 18. Yunnan (YN); and 19. Zhejiang (ZJ). The partial sequences of RdRp gene (327-bp) of CoVs detected in Rhinolophus bats were aligned with those of published represenative CoV strains. The tree was constructed by the maximum-likelihood method with bootstrap values determined with 1000 replicates. The scale bar indicates the estimated number of substitutions per 10 nucleotides. Filled triangles indicate the CoVs published previously by our lab (KU343197, KP876536, KP876544, MF094687, KP876546, KY417143, FJ588686) [15.18.40.41], filled diamonds indicate CoVs detected in this study. Putative novel alphaCoVs are labeled in green. BtCoV/Rh/YN2012 detected in Guangdong and Yunnan province in this study are in bold. FIPV, Feline infectious peritonitis virus; PEDV, procine epidemic diarrhea virus; MHV, mouse hepatitis virus. Other abbreviations are defined as those in the text. Numbers in parentheses indicate numbers of sequences sharing >97% identity.

I doubt that RaBtCoV/4991’s place in that tree was determined based solely on a 370-bp fragment, so I would think that by early 2019, Shi Zhengli’s group would have sequenced its full genome.

Intriguingly, both pangolin-2017 and pangolin-2019 genomes are also very close in this stretch of the RdRp gene, and CoV2 and pangolin-2019 share a few common mutations not found in RaTG13:

Image

But let’s put this topic aside for now and get back to the story of Shi Zhengli’s famous 2013 Nature paper.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

Re: U.S. government gave $3.7 million grant to Wuhan lab at

Postby admin » Wed Jul 29, 2020 8:04 am

Part 2 of 3

“Wuhan-1”

In that paper, Shi Zhengli’s group also reported that by culturing the isolated samples in monkey Vero cells, they managed to isolate a live virus that was almost identical to the Rs3367 strain. The authors named their creation WIV1 (where WIV stands for Wuhan Institute of Virology):

Most importantly, we report the first recorded isolation of a live SL-CoV (bat SL-CoV-WIV1) from bat faecal samples in Vero E6 cells, which has typical coronavirus morphology, 99.9% sequence identity to Rs3367 and uses ACE2 from humans, civets and Chinese horseshoe bats for cell entry. Preliminary in vitro testing indicates that WIV1 also has a broad species tropism.


Let’s compare RaTG13 with Rs3367 and RsSHC014:

Image

As we can see, the spike proteins of these strains are not only 13 amino acids shorter than that of RaTG13, but they also differ in the first quarter of the protein quite substantially. By the way, it is curious that the spike proteins of Rs3367 (aka WIV1) and RsSCH014 are almost identical, and differ only in the RBD region (right sequence below). Almost like CoV2 and RaTG13 (not counting the furin insert):

Image

Could researchers, having received coronavirus samples from pangolins that were intercepted by customs in March 2019, then want to check whether the RBM in pangolin strains can bind to the human ACE2 receptor? And could such researchers also decide to throw an extra furin site in the mix?

Theoretically, of course, they could. From a technical standpoint, it is almost routine for virologists to conduct such experiments. A reasonable question might be: why use RaTG13 as a backbone, and not, say, the tried and true WIV1? Well, it doesn’t have to be either-or: maybe a chimera with WIV1 was also tested. But in parallel, they might have decided to simulate recombination of the pangolin virus with the bat strain closest to it — after all, RaTG13 is much closer to the pangolin strains than WIV1: its spike protein is closer to them both phylogenetically and structurally — it even matches them in length, while the proteins of WIV1/Rs3367 and RsSHC014 are 13 amino acids shorter. Also, the QTQTNS mutation common to RaTG13 and pangolin-2019 (MP789) just before the protease site could not have gone unnoticed by coronavirus experts.


Other Yunnan Strains

In 2011, other researchers had also found samples of coronaviruses from the Yunnan Rhinolophus affinis. The strain LYRa11 seemed to me the most interesting:

Image

But it is also quite distant from RaTG13, and much closer to Rs3367 (that’s the strain that shares 96% with the first SARS-CoV):

Image

But RaTG13, isolated from the same Rhinolophus affinis bats as LYRa11, looks the least like it (left sequence comparison).

Finally, another Yunnan strain (ingenuously named Yunnan2011), isolated in 2011 from another subspecies of horseshoe bats, Rhinolophus pusillus, is even less similar to RaTG13 than LYRa11:

Image

Between themselves, Yunnan2011 and LYRa11 (the right sequence above) are not particularly similar, apart from the highly conserved S2 region. By the way, what’s up with the differing naming conventions for these strains? Sometimes they fully spell out the year, sometimes partially, yet other times not at all (Rs3367). The carrier species sometimes leads (RaTG13), sometimes follows (LYRa11). And what do TG, LY or SHC stand for? Initials of the person sequencing the genome?

Anyways, let’s move on from viral archeology to viral engineering, namely transplanting key areas of the spike protein between species and other gain-of-function (GOF) experiments.


1999: First Chimeric Coronavirus

If you think that all of the gain-of-function coronavirus research into what exactly allows coronaviruses to jump from one species to another began in response to the first SARS outbreak in 2002, you’d be mistaken. Virologists experimented with chimeric coronaviruses long before that. Here, for example, is a 1999 paper from the Dutch group of Peter Rottier from Utrecht University with a revealing title Retargeting of Coronavirus by Substitution of the Spike Glycoprotein Ectodomain: Crossing the Host Cell Species Barrier:

Using targeted RNA recombination, we constructed a mutant of the coronavirus mouse hepatitis virus (MHV) in which the ectodomain of the spike glycoprotein (S) was replaced with the highly divergent ectodomain of the S protein of feline infectious peritonitis virus. The resulting chimeric virus, designated fMHV, acquired the ability to infect feline cells and simultaneously lost the ability to infect murine cells in tissue culture.


By the way, Shi Zhengli seems to have worked under the supervision of Peter Rottier in Utrecht for a time. At least in 2005, she co-authored a joint paper where Utrecht was listed as her affiliation (but her current address was listed at Shanghai Institute). That article itself is quite curious — in it the authors investigated what exactly allows viruses to expand their species tropism:

Only a relatively few mutations in its spike protein allow the murine coronavirus to switch from a murine-restricted tropism to an extended host range by being passaged in vitro. One such virus that we studied had acquired two putative heparan sulfate-binding sites while preserving another site in the furin-cleavage motif. The adaptation of the virus through the use of heparan sulfate as an attachment/entry receptor was demonstrated by increased heparin binding as well as by inhibition of infection through treatment of cells and the virus with heparinase and heparin, respectively.


It is interesting that the furin site in that virus (SRRAHR | SV) is similar to the site in CoV2 (SPRRAR | SV), although in CoV2 it is cut more efficiently due to dual arginines (this is what makes it a polybasic site, i.e. it has multiple basic amino acids in a row in the RxxR sequence):

Image

But what is especially curious is that the mutations that allowed the virus to “expand its horizons” occurred not in animals, but in vitro. Moreover, it seems, they happened pretty quickly:

MHV/pi23, a virus obtained after 23 of the 600 passages that resulted in MHV/BHK, also contains a putative HS-binding site in the S1 domain at the same position as in MHV/BHK, albeit as a smaller insertion, while it lacks the putative HS-binding site immediately upstream of the fusion peptide. MHV/pi23 does infect nonmurine cells to some extent but much less efficiently than MHV/BHK. In addition to the multiple HS-binding sites, however, mutations found in other parts of the S protein, such as the HR1 domain and the putative fusion peptide (Fig. 1), might also contribute to the efficient entry into nonmurine cells. We are currently in the process of determining the S protein mutations that are required for the extended host range phenotype.


Skipping ahead, I’ll just mention that there were other groups that used in vitro mutagenesis to increase the virulence of coronaviruses, for example, MERS:

To better understand the species adaptability of MERS-CoV, we identified a suboptimal species-derived variant of DPP4 to study viral adaption. Passaging virus on cells expressing this DPP4 variant led to accumulation of mutations in the viral spike which increased replication.


Moreover, their mutations arose after just several passages (rounds of cell culture reproduction):

Image
(F) Schematic of single and double mutation emergence in MERS-CoV spike over different passages.
(G) Location of mutations within MERS-CoV spike.


But those experiments occurred much later. In the meantime, let’s go back to 2002 — BEFORE the outbreak of the first SARS-CoV.

Ralph “Trailblazer” Baric

Ralph Baric is a legend in coronavirology. He is a trailblazer of synthetic genomic manipulation techniques. Back in 2002, he published a breakthrough work, which marked a milestone in both the study of various mechanisms of natural viruses and in gain-of-function research. In their paper, the Baric group described creating a synthetic clone of a natural murine coronavirus:

A novel method was developed to assemble a full-length infectious cDNA of the group II coronavirus mouse hepatitis virus strain A59 (MHV-A59). Seven contiguous cDNA clones that spanned the 31.5-kb MHV genome were isolated. The ends of the cDNAs were engineered with unique junctions and assembled with only the adjacent cDNA subclones, resulting in an intact MHV-A59 cDNA construct of ∼31.5 kb in length. The interconnecting restriction site junctions that are located at the ends of each cDNA are systematically removed during the assembly of the complete full-length cDNA product, allowing reassembly without the introduction of nucleotide changes… The method has the potential to be used to construct viral, microbial, or eukaryotic genomes approaching several million base pairs in length and used to insert restriction sites at any given nucleotide in a microbial genome.


Image

In essence, the authors have “translated” the RNA virus into the language of DNA (using reverse transcriptase), which enabled them to manipulate its genome with the help of existing genetic engineering tools. Having created 7 such cDNA provirus segments, the authors then stitched them together “seamlessly” (i.e. without introducing any new, even silent mutations, including new restrictase sites), after which they transcribed their construct back into RNA, which was then translated into virus particles in other cells.

A reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. Reverse transcriptases are used by certain viruses such as HIV and the hepatitis B virus to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, and by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes.

-- Reverse transcriptase, by Wikipedia


SARS-2003

Just a few weeks after the publication of the above work, the first SARS-CoV epidemic broke out. The Baric group sprang into action. By summer of 2003, they have submitted a paper on synthetically recreating SARS-CoV:

Using a panel of contiguous cDNAs that span the entire genome, we have assembled a full-length cDNA of the SARS-CoV Urbani strain, and have rescued molecularly cloned SARS viruses (infectious clone SARS-CoV) that contained the expected marker mutations inserted into the component clones. Recombinant viruses replicated as efficiently as WT virus and both were inhibited by treatment with the cysteine proteinase inhibitor… Availability of a SARS-CoV full-length cDNA provides a template for manipulation of the viral genome, allowing for the rapid and rational development and testing of candidate vaccines and therapeutics against this important human pathogen.


Image

The speed of the Baric group illustrates how quickly a qualified team of virologists can create a synthetic clone from a natural virus, and therefore make genetic modifications to it. Moreover, that was back in 2003. Today, a qualified laboratory can repeat those steps in a matter of weeks.

In fact, two just did: the Swiss have created a synthetic clone of CoV2 in under a month, while it took the Galveston BSL4 lab less than 2 months to do so.

SARS-2006

Baric was the first, but far from the last. Genetic engineering developed by leaps and bounds, creating newer and better tools. Other groups explored alternative synthetic virology techniques. For example, in 2006, Spanish researchers followed in Baric’s footsteps, also creating a synthetic SARS clone, but using an alternative approach (bacterial artificial chromosome):

The engineering of a full-length infectious cDNA clone and a functional replicon of the severe acute respiratory syndrome coronavirus (SARS-CoV) Urbani strain as bacterial artificial chromosomes (BACs) is described in this study. In this system, the viral RNA was expressed in the cell nucleus under the control of the cytomegalovirus promoter and further amplified in the cytoplasm by the viral replicase. Both the infectious clone and the replicon were fully stable in Escherichia coli.



The assembled SARS-CoV infectious cDNA clone was fully stable during its propagation in E. coli DH10B cells for more than 200 generations, considerably facilitating the genetic manipulation of the viral genome (data not shown). The detailed cloning strategy, plasmid maps, and sequences are available upon request.


Image
Strategy to assemble a SARS-CoV infectious cDNA clone as a BAC.
(A) Genetic structure of the SARS-CoV Urbani strain genome. Relevant restriction sites used for the assembly of the full-length cDNA clone are indicated. Numbers in parentheses indicate the genomic positions of the first nucleotide of the restriction endonuclease recognition sequence. Letters and numbers indicate the viral genes. L, leader sequence; UTR, untranslated region; An, poly(A) tail. (B) Construction of pBAC-SARS-CoV 5′-3′. After the selection of appropriate restriction sites, the intermediate plasmid pBAC-SARS-CoV 5′-3′ was constructed as the backbone for assembling the infectious cDNA clone. This plasmid includes the first 681 nt of the genome under the control of the CMV promoter, a multiple-cloning site containing the restriction sites selected for the final assembly of the infectious clone, and the last 975 nt of the genome, followed by a synthetic poly(A) tail (pA), the hepatitis delta virus ribozyme (Rz), and the bovine growth hormone termination and polyadenylation sequences (BGH). All these elements were precisely joined by overlapping PCR. The CMV promoter transcription start and the ribozyme cleavage site are shown. © Schematic diagram showing the five-step cloning strategy used for the assembly of the SARS-CoV full-length cDNA clone. The five overlapping cDNA fragments, named SARS 1 to SARS 5, were sequentially cloned into the plasmid pBAC-SARS-CoV 5′-3′ to generate the plasmid pBAC-SARS-CoVFL. Relevant restriction sites are indicated. The labels are as described for panel A.


True, they didn’t do it as elegantly as Baric, as their final assembly of the synthetic virus included their added restriction enzyme sites, while Baric learned to combine fragments “seamlessly”. But this is a minor point, the Spanish approach is just as robust — in 2013, with its help, the same authors had created a synthetic clone of MERS, and in 2015 their technique was included in a coronavirus textbook (chapter 13).

Wuhan 2007

Let’s get back to 2007. That is when the Shi Zhengli group joined the synthetic virology race with a study of the spike protein of human and bat coronaviruses, trying to determine what exactly is responsible for the ability to skip from one species to another:

A series of S chimeras was constructed by inserting different sequences of the SARS-CoV S into the SL-CoV S backbone.


That is, the authors inserted different segments from the human SARS-CoV spike protein into the spike protein of the bat virus. Here is their conclusion:

From these results, it was deduced that the region from aa 310 to 518 of BJ01-S was necessary and sufficient to convert Rp3-S into a huACE2-binding molecule.


At the same time, they tried to replace shorter fragments, including just the RBM:

For introduction of the RBM of SARS-CoV S into the SL-CoV S, the coding region from aa 424 to 494 of BJ01-S was used to replace the corresponding regions of Rp3-S, resulting in a chimeric S (CS) gene designated CS424–494
.

Given that the above was written in 2007, I think today it will not be difficult for even a novice virologist to replace the RBM of one virus by an RBM from another.

Chimera-2015

In light of the above experiments, it is not very clear what caused the uproar that followed probably the most famous gain-of-function virology paper. I am referring to the joint 2015 work of Shi Zhengli and Ralph Baric, in which they created a synthetic chimeric virus:

Using the SARS-CoV reverse genetics system, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild-type backbone can efficiently use multiple orthologs of the SARS receptor human angiotensin converting enzyme II (ACE2), replicate efficiently in primary human airway cells and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from infection with CoVs using the novel spike protein. On the basis of these findings, we synthetically re-derived an infectious full-length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo.


To me, the authors followed a familiar path: they took the spike-like protein from RsSHC014, which Shi Zhengli isolated from Yunnan bats in 2011, and inserted it into a murine-adapted variant of SARS-CoV for subsequent in vivo experiments. They also tested it in human cells, and almost as an aside created a recombinant clone of the same RsSHC014 strain:

Image
(a) Schematic of the SHC014-CoV molecular clone, which was synthesized as six contiguous cDNAs (designated SHC014A, SHC014B, SHC014C, SHC014D, SHC014E and SHC014F) flanked by unique BglI sites that allowed for directed assembly of the full-length cDNA expressing open reading frames (for 1a, 1b, spike, 3, envelope, matrix, 6–8 and nucleocapsid). Underlined nucleotides represent the overhang sequences formed after restriction enzyme cleavage.

The researchers also uncovered that it was not only the binding of spike protein to the receptor that determined the virus’s potential for transition from one animal species to another, because the SHC014-MA15 chimera was more virulent than SHC014 itself, even in human cells:

Notably, differential tropism in the lung as compared to that with SARS-MA15 and attenuation of full-length SHC014-CoV in [human epithelial airway cell] cultures relative to SARS-CoV Urbani suggest that factors beyond ACE2 binding — including spike processivity, receptor bio-availability or antagonism of the host immune responses — may contribute to emergence.


I especially want to highlight the spike processivity in the quote, because this is not the first time that virologists have mentioned that the ability of a spike protein to be cleaved by proteases (including furin) can have an impact on virulence.

That’s all I have to say about that paper. As a curiosity here is a common photo of its key authors, which was taken in Wuhan, in October 2018. Fittingly, Ralph Bariс and Shi Zhengli are front and center. I call this photo “The Wuhan Clan”. (Sorry, couldn’t resist).

Image

Murine SARS-2007

One quick aside regarding the “murine virus MA15” from the above paper. That was not some kind of natural murine coronavirus, as one might think. It was a laboratory-modified human SARS-CoV, which back in 2007 the Baric group — possibly in competition with the Shi Zhengli group (remember their article from 2007) — turned into a real beast. To do this, they first iteratively “improved” it in mice, and when after several iterations it became maximally “effective”, they reproduced the observed mutations in a synthetic clone, and once again checked that it really does have increased virulence and lethality:

We adapted the SARS-CoV (Urbani strain) by serial passage in the respiratory tract of young BALB/c mice. Fifteen passages resulted in a virus (MA15) that is lethal for mice following intranasal inoculation. Lethality is preceded by rapid and high titer viral replication in lungs, viremia, and dissemination of virus to extrapulmonary sites accompanied by lymphopenia, neutrophilia, and pathological changes in the lungs. Abundant viral antigen is extensively distributed in bronchial epithelial cells and alveolar pneumocytes, and necrotic cellular debris is present in airways and alveoli, with only mild and focal pneumonitis. These observations suggest that mice infected with MA15 die from an overwhelming viral infection with extensive, virally mediated destruction of pneumocytes and ciliated epithelial cells. The MA15 virus has six coding mutations associated with adaptation and increased virulence; when introduced into a recombinant SARS-CoV, these mutations result in a highly virulent and lethal virus (rMA15), duplicating the phenotype of the biologically derived MA15 virus. Intranasal inoculation with MA15 reproduces many aspects of disease seen in severe human cases of SARS.


Baric-2008

Here is another example of the potential scientific rivalry between the Baric and Shi Zhengli groups. In 2008, the Baric group took the Bat-SCoV strain and replaced its RBD with an RBD from human SARS. That is, they essentially reproduced the work of Shi Zhengli’s group from 2007, except they didn’t limit themselves to pseudo-viruses, but created a real chimeric virus:

As compared to a live virus, pseudoviruses, which can be either naturally produced during an infection or artificially in a laboratory for research purposes, contain fragments of host-cell DNA without containing any of the nucleic acid components of the infectious virus to which they are related.

The modified genetic material of pseudoviruses prevents these particles from producing viral surface proteins on their own unless an additional plasmid or stable cell line that expresses such proteins are made available to the pseudovirus.

-- What is a Pseudovirus?, by News Medical Life Sciences


Here, we report the design, synthesis, and recovery of the largest synthetic replicating life form, a 29.7-kb bat severe acute respiratory syndrome (SARS)-like coronavirus (Bat-SCoV), a likely progenitor to the SARS-CoV epidemic.



To test whether the RBDs of Bat-SCoV and SARS-CoV were interchangeable, we replaced the Bat-SCoV RBD (amino acid 323–505) with the SARS-CoV RBD (amino acid 319–518) (27, 28) (GenBank accession no. FJ211860), simulating a theoretical recombination event that might occur during mixed infection in vivo (Fig. 1B).


Image
(B) Schematic representation showing organization of the SARS-CoV and Bat-SCoV Spike proteins. The engineered Spike proteins are pictured below with the virus name to the left. Bat-SRBD includes all of the Bat-SCoV Spike sequence except that the Bat-SCoV RBD (Bat-SCoV amino acid 323–505) is replaced with the SARS-CoV RBD (amino acid 319–518) (GenBank accession no. FJ211860). Bat-SRBD-MA includes the MA15 Spike RBD change at SARS-CoV aa Y436H. Bat-SRBM includes the minimal 13 SARS-CoV residues critical for ACE2 contact, resulting in a chimeric RBD of Bat-SCoV amino acid 323I-429T and SARS-CoV amino acid 426R-518D. Bat-Hinge is Bat-SRBM sequence, with Bat-SCoV amino acid 392L-397E replaced with SARS-CoV amino acid 388V-393D. Bat-F includes nt 1–24057 of SARS-CoV (to Spike amino acid 855), with the remaining 3′ sequence from Bat-SCoV. To the right of the schematic representations, observation of transcript activity and approximate stock titers at passage 1 (P1) are indicated. ND indicates no infectious virus detected by plaque assay.

Baric-2016

The Baric group does seem to have its share of similar papers. For example, in 2016, they essentially repeated their collaboration with Shi Zhengli from 2015 to create a chimeric virus, only this time they inserted a spike protein segment into their mouse-adapted SARS not from RsSCH014, but from another strain Shi Zhengli found in Yunnan — its close relative Rs3367. Or, to be exact, from WIV1 — the laboratory clone of Rs3367 isolated at the Wuhan Institute of Virology in 2013:

Using the SARS-CoV infectious clone as a template (7), we designed and synthesized a full-length infectious clone of WIV1-CoV consisting of six plasmids that could be enzymatically cut, ligated together, and electroporated into cells to rescue replication competent progeny virions (Fig. S1A). In addition to the full-length clone, we also produced WIV1-CoV chimeric virus that replaced the SARS spike with the WIV1 spike within the mouse-adapted backbone (WIV1-MA15, Fig. S1B). … To confirm growth kinetics and replication, Vero cells were infected with SARS-CoV Urbani, WIV1-MA15, and WIV1-CoV.


Image

To me, the 2016 paper looks a lot like the 2015 one. Moreover, its rationale is not very clear to me: after all, WIV1/Rs3367 already shared 96% of their genome with SARS-CoV. So I am not sure why one would want to insert a spike protein from its closest relative back into SARS-CoV. Maybe just because they could. In this light, the title of the article acquires a certain duality: SARS-like WIV1-CoV poised for human emergence.

Oh, and I am not sure how in 2015 Baric was granted a patent for the creation of “chimeric coronavirus spike proteins”, given all that he and Shi Zhengli previously disclosed in their papers long before 2015.


Baric-1990

Just so you appreciate how long Ralph Baric has been at this game — he was designing recombinant coronaviruses way before there were any DNA sequencing machines or other modern tools of genetic engineering. Here is his paper on the creation of “temperature mutants” from mouse coronavirus from 1990:

The A59 strain of mouse hepatitis virus (MHV-A59) was used throughout the course of this study. Virus was propagated and cloned three times in the continuous murine astrocytoma cell line (DBT).



Various combinations of [temperature sensitive] mutants were mixed and inoculated onto cells at a multiplicity of infection of 10 each.


So Dr. Baric has been creating mutant viruses for over 30 years.

Wuhan-2017

The Shi Zhengli group has also not been idle since the famous 2015 paper. In 2017, they published a paper where they reported creating not one but 8 chimeric viruses — all made using transplanted RBDs from bat SARS-like viruses which they collected over a span of 5 years from the very cave around Kunming, Yunnan Province, where Shi Zhengli originally found Rs3367 and RsSCH014.

Using the reverse genetics technique we previously developed for WIV1 [23], we constructed a group of infectious bacterial artificial chromosome (BAC) clones with the backbone of WIV1 and variants of S genes from 8 different bat SARSr-CoVs. Only the infectious clones for Rs4231 and Rs7327 led to cytopathic effects in Vero E6 cells after transfection (S7 Fig). The other six strains with deletions in the RBD region, Rf4075, Rs4081, Rs4085, Rs4235, As6526 and Rp3 (S1 Fig) failed to be rescued, as no cytopathic effects was observed and viral replication cannot be detected by immunofluorescence assay in Vero E6 cells (S7 Fig). In contrast, when Vero E6 cells were respectively infected with the two successfully rescued chimeric SARSr-CoVs, WIV1-Rs4231S and WIV1-Rs7327S, and the newly isolated Rs4874, efficient virus replication was detected in all infections (Fig 7).


Image
Similarity plot based on the full-length genome sequence of civet SARS CoV SZ3.
Full-length genome sequences of all SARSr-CoV detected in bats from the cave investigated in this study were used as reference sequences. The analysis was performed with the Kimura model, a window size of 1500 base pairs and a step size of 150 base pairs.


The authors then checked if their chimeras can infect human cells, and this time they used a live synthetic virus, rather than not pseudo-typed HIV constructs as before:

To assess whether the three novel SARSr-CoVs can use human ACE2 as a cellular entry receptor, we conducted virus infectivity studies using HeLa cells with or without the expression of human ACE2. All viruses replicated efficiently in the human ACE2-expressing cells. The results were further confirmed by quantification of viral RNA using real-time RT-PCR (Fig 8).


Baric-2019

Ralph Baric also showed no signs of slowing down. At the end of October 2019, his group submitted for publication another paper on the importance of spike protein protease cleavage (remember the furin site?) to crossing the “barrier to zoonotic infection” by coronaviruses:

Together, these results demonstrate that protease cleavage is also the primary barrier to infection of Vero cells with HKU5-CoV. Examining further, we compared the predicted cleavage at S1/S2 border, S2’, and the endosomal cysteine protease site across MERS, PDF2180, and HKU5 spikes (Fig. 6D) (26). For the S1/S2 site, MERS, Uganda, and HKU5 maintain the RXXR cleavage motif, although the different interior amino acids may alter efficiency. For the S2’ sequence, MERS and HKU5 also retain the RXXR motif; however, the Uganda spike lacks the first arginine (SNAR), potentially impacting cleavage.


As I recall the spirit of scientific competition between the groups of Baric and Shi Zhengli, I can’t help but wonder whether someone was conducting similar research in the Wuhan lab in 2019.

Gain-of-Function: Risky Business

Many people who first learn about the above research ask a very valid question: “But why?” Why do scientists create chimeric killer viruses? The politically correct answer is to develop preventive measures (drugs or vaccines) from possible natural chimeras and to understand the risks of their occurrence. Here, in fact, is what Baric, Shi Zhengli, and co-authors themselves wrote on this subject in their famous 2015 paper:

In addition to offering preparation against future emerging viruses, this approach must be considered in the context of the US government–mandated pause on gain-of-function (GOF) studies. On the basis of previous models of emergence (Fig. 4a,b), the creation of chimeric viruses such as SHC014-MA15 was not expected to increase pathogenicity. Although SHC014-MA15 is attenuated relative to its parental mouse-adapted SARS-CoV, similar studies examining the pathogenicity of CoVs with the wild-type Urbani spike within the MA15 backbone showed no weight loss in mice and reduced viral replication. Thus, relative to the Urbani spike–MA15 CoV, SHC014-MA15 shows a gain in pathogenesis (Fig. 1). On the basis of these findings, scientific review panels may deem similar studies building chimeric viruses based on circulating strains too risky to pursue, as increased pathogenicity in mammalian models cannot be excluded. Coupled with restrictions on mouse-adapted strains and the development of monoclonal antibodies using escape mutants, research into CoV emergence and therapeutic efficacy may be severely limited moving forward. Together, these data and restrictions represent a crossroads of GOF research concerns; the potential to prepare for and mitigate future outbreaks must be weighed against the risk of creating more dangerous pathogens. In developing policies moving forward, it is important to consider the value of the data generated by these studies and whether these types of chimeric virus studies warrant further investigation versus the inherent risks involved.


Were these words prophetic? At the end of 2014, the United States introduced a moratorium on state financing of such gain-of-function studies, but it was shortly canceled (in 2017). In China, no moratorium on such studies was introduced, on the contrary, they went full steam ahead with creating new “super labs” of the highest biosafety level (BSL-4), as in 2017 in Wuhan:

Image

To be clear, the Wuhan lab was allowed to work with coronaviruses even before 2017, as these viruses only required a BSL-3 rating which the Wuhan Institute of Virology had. But their aspirations to obtain BSL-4 made a lot of people uneasy, including fellow researchers:

Future plans include studying the pathogen that causes SARS, which also doesn’t require a BSL-4 lab, before moving on to Ebola and the West African Lassa virus, which do. Some one million Chinese people work in Africa; the country needs to be ready for any eventuality, says Yuan. “Viruses don’t know borders.”



The plan to expand into a network heightens such concerns. One BSL-4 lab in Harbin is already awaiting accreditation; the next two are expected to be in Beijing and Kunming, the latter focused on using monkey models to study disease.

Lina says that China’s size justifies this scale, and that the opportunity to combine BSL-4 research with an abundance of research monkeys — Chinese researchers face less red tape than those in the West when it comes to research on primates — could be powerful. “If you want to test vaccines or antivirals, you need a non-human primate model,” says Lina.

But Ebright is not convinced of the need for more than one BSL-4 lab in mainland China. He suspects that the expansion there is a reaction to the networks in the United States and Europe, which he says are also unwarranted. He adds that governments will assume that such excess capacity is for the potential development of bioweapons.

“These facilities are inherently dual use,” he says. The prospect of ramping up opportunities to inject monkeys with pathogens also worries, rather than excites, him: “They can run, they can scratch, they can bite.”


Trevan says China’s investment in a BSL-4 lab may, above all, be a way to prove to the world that the nation is competitive. “It is a big status symbol in biology,” he says, “whether it’s a need or not.”


Interestingly, in addition to Wuhan, the Chinese government planned to open a new BSL-4 lab in Kunming, with an eye to testing vaccines on primates. As you might recall, Kunming is not only the capital of Yunnan, but it is also where Shi Zhengli found the strains Rs3367 and RsSHC014 in nearby caves. By the way, primate testing was mentioned by Baric and Shi Zhengli as possible next steps for the development of preventive vaccines against potential future outbreaks of coronaviruses in their famous 2015 paper:

However, further testing in nonhuman primates is required to translate these finding into pathogenic potential in humans. Importantly, the failure of available therapeutics defines a critical need for further study and for the development of treatments. With this knowledge, surveillance programs, diagnostic reagents and effective treatments can be produced that are protective against the emergence of group 2b–specific CoVs, such as SHC014, and these can be applied to other CoV branches that maintain similarly heterogeneous pools.


Maybe by 2019 the creation and testing of potential vaccines against various SARS-like coronaviruses was already in full swing.
admin
Site Admin
 
Posts: 41220
Joined: Thu Aug 01, 2013 5:21 am

PreviousNext

Return to Health

Who is online

Users browsing this forum: No registered users and 2 guests